» About     » Archive     » Submit     » Authors     » Search     » Random     » Specials     » Statistics     » Forum     » Facebook     » RSS Feed     Updates Daily

Archive

2008-11-15  No. 1  Garfield in Haiku
2008-11-17  No. 2  Garfield Plus Garfield
2008-11-22  No. 3  Recursive Garfield
2008-11-24  No. 4  Choose Your Own Garfield
2008-11-25  No. 5  Qwantzfield
2008-11-28  No. 6  Silent-Era Garfield
2008-12-02  No. 7  Mystical Garfield
2008-12-04  No. 8  Mix-n-Match Recaption Garfield
2008-12-05  No. 9  Colour-Averaged Garfield: 2007
2008-12-08  No. 10  Garfield Plus Penultimate Beat Panel
2008-12-09  No. 11  Garfield on a Neutron Star
2008-12-10  No. 12  The Garfield & Poochie Show
2008-12-11  No. 13  Garfocal
2008-12-15  No. 14  Ellen
2008-12-17  No. 15  Garfield Divided by Garfield
2008-12-19  No. 16  Uncomfortably Close Garfield
2008-12-22  No. 17  The Garfield Code
2008-12-24  No. 18  Garfield/Jon Reversal
2008-12-26  No. 19  Garfield Divided by Garfield
2008-12-29  No. 20  Colour-Averaged Garfield: 1978
2008-12-31  No. 21  NESfield
2009-01-02  No. 22  Garfield-Star Runner
2009-01-05  No. 23  Garfield Zen
2009-01-07  No. 24  Garfield meets mezzacotta
2009-01-09  No. 25  Reversed Garfield
2009-01-12  No. 26  Polar Coordinate Transform Garfield
2009-01-14  No. 27  Garfield Meets Zeus
2009-01-16  No. 28  Garfield Without Words
2009-01-19  No. 29  Circumference of Garfield
2009-01-21  No. 30  Garfield in Microgravity
2009-01-23  No. 31  Garfield in Wonderland
2009-01-26  No. 32  Garfield Without Words
2009-01-28  No. 33  Garfield's D-Leif Rag
2009-01-30  No. 34  Steganographic Garfield
2009-02-02  No. 35  Garfield #1 Gold Foil Embossed Collector's Edition
2009-02-04  No. 36  Garfield: The Video Game
2009-02-06  No. 37  Gadjifantolim
2009-02-09  No. 38  Garfield Rescue!
2009-02-11  No. 39  Garfield on a Postcard
2009-02-13  No. 40  Recursive Thinking Garfield
2009-02-16  No. 41  Irregularfield
2009-02-18  No. 42  36×10 Garfield
2009-02-20  No. 43  Fourier Transformed Garfield
2009-02-23  No. 44  Garfield Retold
2009-02-25  No. 45  Plush Garfield
2009-02-27  No. 46  Garfield's Inferno
2009-03-02  No. 47  Layered Garfield
2009-03-04  No. 48  Garfield Minus Jon
2009-03-06  No. 49  Andy Warfield
2009-03-09  No. 50  Reversed Garfield
2009-03-11  No. 51  Dark Side of the Lasagne
2009-03-13  No. 52  Plush Garfield
2009-03-16  No. 53  Garfield Minus Jon
2009-03-18  No. 54  Censored Garfield
2009-03-20  No. 55  Zoomed-out Garfield
2009-03-23  No. 56  Derivative of Garfield
2009-03-25  No. 57  No Time for the Dog!
2009-03-27  No. 58  867-5309/Jonny
2009-03-30  No. 59  CAD + Garfield
2009-04-01  No. 60  Garfish
2009-04-03  No. 61  Garfield at Night
2009-04-06  No. 62  Flea Grid
2009-04-08  No. 63  John, Paul, George, and Ringo (and Garfield and Odie)
2009-04-10  No. 64  Garfield ∩ Garfield
2009-04-13  No. 65  xkcfield
2009-04-15  No. 66  Broken Vertical Hold Garfield
2009-04-17  No. 67  Signal to Noise
2009-04-20  No. 68  Welsh Sound Effect Garfield
2009-04-22  No. 69  Garfield Minus Garfield, Value Added: Help Me Do Nothing
2009-04-24  No. 70  Reversed Garfield - Variant
2009-04-27  No. 71  Garfield Minus Garfield, Value Added: Woo, woo, woo
2009-04-29  No. 72  Meditations on Garfield
2009-05-01  No. 73  Garfield Minus Garfield, Value Added: Mysterious
2009-05-04  No. 74  Plush Garfield: Reproportioned Jon
2009-05-06  No. 75  Liz Minus (Garfield and Jon)
2009-05-08  No. 76  Identity Function Garfield
2009-05-11  No. 77  Garfield Minus Garfield Minus Jon
2009-05-13  No. 78  Garfield & Hobbes
2009-05-15  No. 79  Liz and Jon's Father Minus Jon but Plus Each Other
2009-05-18  No. 80  Zero Function Garfield
2009-05-20  No. 81  James A. Garfield
2009-05-22  No. 82  xkcd minus Garfield
2009-05-25  No. 83  Garfield minus xkcd
2009-05-27  No. 84  Garfield minus Jon plus Calvin
2009-05-28  No. 85  Paintfield
2009-05-29  No. 86  Garfield's Other Dog
2009-06-01  No. 87  Square Root of ((Minus Garfield) Squared)
2009-06-03  No. 88  Mezzacotta Garfield
2009-06-04  No. 89  Garfield Minus More Garfield Than Ever
2009-06-05  No. 90  Garfield Meets "Happiness is a Warm Puppy"
2009-06-08  No. 91  Imaginary Garfield: Mousey
2009-06-10  No. 92  The Guy Who Can't Draw Garfield
2009-06-11  No. 93  Garfield Top Twenty
2009-06-12  No. 94  Garfield Minus Everybody Else
2009-06-15  No. 95  Imaginary Garfield: Mouser
2009-06-17  No. 96  Garfield Minus Everything Else
2009-06-18  No. 97  Imaginary Garfield: Coffee Party
2009-06-24  No. 98  Exquisite Garfield
2009-06-25  No. 99  Pimp My Garfield
2009-06-26  No. 100  Recursive Garfield Redux
2009-06-29  No. 101  Garfield Retold Retold
2009-06-30  No. 102  Pulp Media Garfield
2009-07-01  No. 103  Garfield Divided by Cloverfield
2009-07-02  No. 104  Garfield Minus Characters
2009-07-03  No. 105  Politigarfield
2009-07-06  No. 106  Jon
2009-07-07  No. 107  Birthday Garfield
2009-07-08  No. 108  Goldfield
2009-07-09  No. 109  April of No Sundays Collection
2009-07-10  No. 110  Garfield IN SPACE!
2009-07-13  No. 111  Why So Serious?
2009-07-14  No. 112  Barfield
2009-07-15  No. 113  Sunday Every Day
2009-07-16  No. 114  Why So Serious? - Take 2
2009-07-17  No. 115  Trichromatic Garfield
2009-07-20  No. 116  Spacious Garfield
2009-07-21  No. 117  Why So Serious? - Take 3
2009-07-22  No. 118  Cold-Warm Involution Garfield
2009-07-23  No. 119  Frozen Garfield
2009-07-24  No. 120  Dissociated Garfield
2009-07-27  No. 121  A Softer Cat
2009-07-28  No. 122  Lolfield
2009-07-29  No. 123  Cyclops Garfield
2009-07-30  No. 124  Krazy minus Kat
2009-07-31  No. 125  Mix and Match Garfield
2009-08-03  No. 126  Garfield Plus i times Odie
2009-08-04  No. 127  A Week in a Day
2009-08-05  No. 128  Garfield Minus (Garfield Minus Garfield)
2009-08-06  No. 129  Frank Miller's Garfield
2009-08-07  No. 130  Square Roots of Garfield
2009-08-10  No. 131  Garfield: Lost in Translation Minus Garfield
2009-08-11  No. 132  Jon Loses His Lunch
2009-08-12  No. 133  Garklife
2009-08-13  No. 134  9 Garfield Lane
2009-08-14  No. 135  The Happiest Dog in the World
2009-08-17  No. 136  Jon's Boo-Boo
2009-08-18  No. 137  Sixth Roots of Garfield
2009-08-19  No. 138  Realfield
2009-08-20  No. 139  A Strip. With. A Snail.
2009-08-21  No. 140  Garfield Plus Tree
2009-08-24  No. 141  Garfield Recoloured
2009-08-25  No. 142  Bob and George featuring Odie
2009-08-26  No. 143  A Little Something Different
2009-08-27  No. 144  Garfield vs. the Laugh-Out-Loud Cats
2009-08-28  No. 145  Garfield Negative Space
2009-08-31  No. 146  Mezzafield
2009-09-01  No. 147  Garfield's Contractual Requirement
2009-09-02  No. 148  An Unguarded Hamburger
2009-09-03  No. 149  House of Garfields
2009-09-04  No. 150  Is that just cool or what?
2009-09-07  No. 151  Talking Garfield
2009-09-08  No. 152  Garfield Minus Garfield Minus Jon Minus Odie Minus Nermal Minus Arlene Minus Lyman Minus Liz Minus Pookie
2009-09-09  No. 153  Garfield Is the Perfect Disguise
2009-09-10  No. 154  Garf-life
2009-09-11  No. 155  It's Just One of Those Days
2009-09-14  No. 156  Square Root of Negative Garfield
2009-09-15  No. 157  Garfield Meets Unauthorised Calvin
2009-09-16  No. 158  Minus Garfield
2009-09-17  No. 159  urururururururur
2009-09-18  No. 160  (Garfield minus Jon) Divided by Garfield
2009-09-21  No. 161  Concerned Garfield
2009-09-22  No. 162  Garfield Retold Minus Garfield
2009-09-23  No. 163  Meta-Garfield
2009-09-24  No. 164  Jon's Chat Screen
2009-09-25  No. 165  Polterfield
2009-09-28  No. 166  Fun With Hair Day
2009-09-29  No. 167  Why So Serious? - Final Take
2009-09-30  No. 168  Indexed Colour Garfield
2009-10-01  No. 169  The Bunny Slipper Diet
2009-10-02  No. 170  Ledge
2009-10-05  No. 171  Choose Your Own Punchline
2009-10-06  No. 172  Jon: Jon Minus Minus Mouse Catching
2009-10-07  No. 173  Comic Without Garfield
2009-10-08  No. 174  Jon: Jon's Snapped Mind
2009-10-09  No. 175  Garfield Really Minus Garfield
2009-10-12  No. 176  Garfield with Bad Words
2009-10-13  No. 177  Reversed Garfield, and ditto Jon
2009-10-14  No. 178  Darkfield
2009-10-15  No. 179  Garfield Minas Garfield
2009-10-16  No. 180  Garfield Cross Section A
2009-10-19  No. 181  Jon Roughs It
2009-10-20  No. 182  Boomtown Cats
2009-10-21  No. 183  Little Garfield Lost
2009-10-22  No. 184  Garfield Cross Section B
2009-10-23  No. 185  Humans Are Nice
2009-10-26  No. 186  Garfield Cross Section C
2009-10-27  No. 187  Pokemon Orange
2009-10-28  No. 188  Impressionist Garfield
2009-10-29  No. 189  Hark! A Vagrant Minus Garfield!
2009-10-30  No. 190  Garfield of the Old Republic
2009-11-02  No. 191  Garfield Miners Garfield
2009-11-03  No. 192  Garfield Mosaic
2009-11-04  No. 193  The Angriest Cat in the World
2009-11-05  No. 194  New Perspective
2009-11-06  No. 195  Jonfield
2009-11-09  No. 196  Beware of Giygas
2009-11-10  No. 197  Jon: Nap Attack
2009-11-11  No. 198  Variations on a Haircut #1
2009-11-12  No. 199  Garfield Replacement
2009-11-13  No. 200  Gar Field
2009-11-16  No. 201  thegarfieldian
2009-11-17  No. 202  Gravfield
2009-11-18  No. 203  Shadow Garfield
2009-11-19  No. 204  The Cat
2009-11-20  No. 205  Variations on a Haircut #2
2009-11-23  No. 206  Jon: Nap Attack for Salt
2009-11-24  No. 207  Reversed Text Garfield
2009-11-25  No. 208  Garfield Mosaic 2
2009-11-26  No. 209  Odiefield
2009-11-27  No. 210  Garfieldarama
2009-11-30  No. 211  Antiderivative of Square Root of Minus Garfield
2009-12-01  No. 212  (Re)create with Garfield!
2009-12-02  No. 213  All-Star Garfield and Odie The Wonder Dog
2009-12-03  No. 214  Garfield at 56kbps
2009-12-04  No. 215  Garfield + 24 Years
2009-12-07  No. 216  "I Wanna be the Garfield" by Square Root of Castlevania
2009-12-08  No. 217  Talking Scale Minus Garfield... ?
2009-12-09  No. 218  Garfield Music
2009-12-10  No. 219  Gracefield
2009-12-11  No. 220  Mirror-Image Garfield
2009-12-14  No. 221  Replaced
2009-12-15  No. 222  Blue Screen of Garfield
2009-12-16  No. 223  Mirrored Garfield
2009-12-17  No. 224  Garfield as a Number
2009-12-18  No. 225  Jon - Why Jon Can't Go Grocery Shopping
2009-12-21  No. 226  Fluffy
2009-12-22  No. 227  Less Humour, More Story!
2009-12-23  No. 228  Nagging Feeling
2009-12-24  No. 229  Fridge Logic
2009-12-25  No. 230  Just Look At That Gorgeous Garfield
2009-12-28  No. 231  Garfield Minas Tirith
2009-12-29  No. 232  Garfield Minus Garfield Minus Outside Panel Frames
2009-12-30  No. 233  Garfield/3
2009-12-31  No. 234  The Vampire Garfield Chronicles
2010-01-01  No. 235  Moooo
2010-01-04  No. 236  Garfield Cross Section D
2010-01-05  No. 237  The Computer is Your Friend
2010-01-06  No. 238  Continuity: Positive
2010-01-07  No. 239  Unprovoked
2010-01-08  No. 240  Jon - The Prisoner
2010-01-11  No. 241  Continuity: Negative
2010-01-12  No. 242  Advantages to Growing Older
2010-01-13  No. 243  A Nightmare on Elm Street
2010-01-14  No. 244  Jon the Clueless Witness
2010-01-15  No. 245  Candid Camera Garfield
2010-01-18  No. 246  Head to Tail
2010-01-19  No. 247  Oh Snap!
2010-01-20  No. 248  Catchless Garfield
2010-01-21  No. 249  garfield minus.
2010-01-22  No. 250  Garfapteryx
2010-01-25  No. 251  Beware
2010-01-26  No. 252  Grey
2010-01-27  No. 253  Garfloraled, Part 1
2010-01-28  No. 254  Almost Everywhere Zero Garfield
2010-01-29  No. 255  Fun With Hair Day Minus Garfield
2010-01-30  No. 256  It's an Old, Old World
2010-01-31  No. 257  Rice
2010-02-01  No. 258  Garfloraled, Part 2
2010-02-02  No. 259  Garfield Shrink & Re-enlarge, Part 1
2010-02-03  No. 260  Garfield - Schrödinger's Cat
2010-02-04  No. 261  Garfield Shrink & Re-enlarge, Part 2
2010-02-05  No. 262  Jon, Paranoid
2010-02-06  No. 263  Garfield Shrink & Re-enlarge, Part 3
2010-02-07  No. 264  JPEGarfield
2010-02-08  No. 265  Garfield Shrink & Re-enlarge, Part 4
2010-02-09  No. 266  Mirror Universe Garfield
2010-02-10  No. 267  Garfloraled, Part 3
2010-02-11  No. 268  Garfield Linus Garfield
2010-02-12  No. 269  Morbid Garfield
2010-02-13  No. 270  RPGarfield
2010-02-14  No. 271  Elvield
2010-02-15  No. 272  Grinfield
2010-02-16  No. 273  Night Garfield
2010-02-17  No. 274  Schrödinger's Cat: Reloaded
2010-02-18  No. 275  One Small Push...
2010-02-19  No. 276  Small Talk
2010-02-20  No. 277  Many-Worlds Garfield
2010-02-21  No. 278  Garfield Dream
2010-02-22  No. 279  Vertical Garfield
2010-02-23  No. 280  Yoda Garfield
2010-02-24  No. 281  Breaking the 4th Wall
2010-02-25  No. 282  Anaglyphfield
2010-02-26  No. 283  Free Floating Garfield
2010-02-27  No. 284  Cats of the Old Republic
2010-02-28  No. 285  Gallagherfield
2010-03-01  No. 286  Lemmy Arbuckle Minus Garfield
2010-03-02  No. 287  Delta Garfield
2010-03-03  No. 288  Garbert, Evil Director of Human Resources
2010-03-04  No. 289  Jon Snapped
2010-03-05  No. 290  Create.swf Garfield
2010-03-06  No. 291  Pictures for Sad Kittens
2010-03-07  No. 292  Clobberin' Time
2010-03-08  No. 293  i
2010-03-09  No. 294  Tung
2010-03-10  No. 295  Feet
2010-03-11  No. 296  Nermal Minus Garfield
2010-03-12  No. 297  Garfield versus Odie's Dark Abyss of a Soul
2010-03-13  No. 298  A Bomb
2010-03-14  No. 299  2 Panel Garfield
2010-03-15  No. 300  Garfield Minus Garfield Minus Speech Bubbles
2010-03-16  No. 301  Ask Dr. Stupid
2010-03-17  No. 302  Looky Looky
2010-03-18  No. 303  Möbius Strip
2010-03-19  No. 304  Mr. Wolverine
2010-03-20  No. 305  Hey Evelyn, Nice Shot
2010-03-21  No. 306  Garfield Minus Food
2010-03-22  No. 307  Subliminal Garfield
2010-03-23  No. 308  Window Blind Story
2010-03-24  No. 309  Calm Break
2010-03-25  No. 310  Garfield, 2 Seconds Out-of-Sync
2010-03-26  No. 311  Fishy Story
2010-03-27  No. 312  The End of the Universe I: Heat Death
2010-03-28  No. 313  Shifting Mid-Point
2010-03-29  No. 314  Reversed Strip
2010-03-30  No. 315  Garfield Epic #1
2010-03-31  No. 316  Garfield/0
2010-04-01  No. 317  The Thing
2010-04-02  No. 318  Garfield in Haiku 2
2010-04-03  No. 319  Garfield Epic #2
2010-04-04  No. 320  The End of the Universe II: The Big Rip
2010-04-05  No. 321  Garfield Minus Garfield Plus James A. Garfield
2010-04-06  No. 322  The Cat Who Says "Ni!"
2010-04-07  No. 323  Accidental Garfield
2010-04-08  No. 324  Garfield Epic #3
2010-04-09  No. 325  Reproduction of a Fictional Strip
2010-04-10  No. 326  Garfield Times Garfield
2010-04-11  No. 327  AverageGarfield
2010-04-12  No. 328  Garfield of Leaves
2010-04-13  No. 329  Smile
2010-04-14  No. 330  Garfield
2010-04-15  No. 331  A Garfield World
2010-04-16  No. 332  Garfield Linus Garfield, Part 2
2010-04-17  No. 333  RobLiefield
2010-04-18  No. 334  Shedding
2010-04-19  No. 335  Garfield Linux Garfield
2010-04-20  No. 336  TV Moth
2010-04-21  No. 337  Garfield Sinus Garfield
2010-04-22  No. 338  Hubert & Reba
2010-04-23  No. 339  Déjà vu all over again
2010-04-24  No. 340  Blindsided
2010-04-25  No. 341  Stay Calm!
2010-04-26  No. 342  Good ol' Garfield Brown
2010-04-27  No. 343  Garfield Undergoes Chickification
2010-04-28  No. 344  The Necronomicon
2010-04-29  No. 345  The Garfield Conspiracy
2010-04-30  No. 346  iField
2010-05-01  No. 347  Accessorize
2010-05-02  No. 348  Up To Something
2010-05-03  No. 349  Alternate Garfield
2010-05-04  No. 350  Subliminal Revealed Garfield
2010-05-05  No. 351  Height-Mapped Garfield
2010-05-06  No. 352  Garfield, Minus, Garfield
2010-05-07  No. 353  Little Sandwich
2010-05-08  No. 354  Garfield Minus Monster
2010-05-09  No. 355  Blue Mouse Group
2010-05-10  No. 356  Beam Garfield
2010-05-11  No. 357  Odie Minus Garfield
2010-05-12  No. 358  Anorexic Garfield
2010-05-13  No. 359  Noirfield
2010-05-14  No. 360  Blasphemous Garfield
2010-05-15  No. 361  For Science!
2010-05-16  No. 362  Bored Garfield
2010-05-17  No. 363  Garfield minus Jon minus Speech Bubbles
2010-05-18  No. 364  Keep Off the Grass
2010-05-19  No. 365  Birthday
2010-05-20  No. 366  Jon's Point of View
2010-05-21  No. 367  ASCIIfield
2010-05-22  No. 368  Height-Mapped Garfield #2
2010-05-23  No. 369  Wilhelm Scream-field
2010-05-24  No. 370  sudoGarfield
2010-05-25  No. 371  Entertainment System
2010-05-26  No. 372  Manga Garfield
2010-05-27  No. 373  Bored Garfield: 2
2010-05-28  No. 374  A Visit from Cousin Kenny
2010-05-29  No. 375  One Over Garfield: 1
2010-05-30  No. 376  Garfield Minus Garfield Plus Six
2010-05-31  No. 377  Destructive Garfield
2010-06-01  No. 378  Jon, Jon, Jon
2010-06-02  No. 379  Chicken Trying to Gargle a Bowling Ball
2010-06-03  No. 380  Cube Root of Garfield
2010-06-04  No. 381  Lost in Translation Garfield
2010-06-05  No. 382  Ice, Ice, Garfield
2010-06-06  No. 383  One Over Garfield: 2
2010-06-07  No. 384  Garfield Midas Garfield
2010-06-08  No. 385  Ticket Out Of Here
2010-06-09  No. 386  Garfield Minus Everything
2010-06-10  No. 387  GGAGCTCGTTTTATCGAGCTCGAT
2010-06-11  No. 388  Garfield Squared
2010-06-12  No. 389  Darkerfield
2010-06-13  No. 390  Garfield Lino Garfield
2010-06-14  No. 391  Digital Garfield
2010-06-15  No. 392  Changefield
2010-06-16  No. 393  ASCIIfield Mark II
2010-06-17  No. 394  Changes Everything
2010-06-18  No. 395  One Over Garfield: 3
2010-06-19  No. 396  Garfield Minus Hallucinations
2010-06-20  No. 397  R.I.P.
2010-06-21  No. 398  Garfield Linus Garfield, Part 3
2010-06-22  No. 399  Digital Grey 'n' Dull
2010-06-23  No. 400  e to the Garfield
2010-06-24  No. 401  Width
2010-06-25  No. 402  Garfield Minus Pooky
2010-06-26  No. 403  Half-Panelled Garfield
2010-06-27  No. 404  Changefield #2
2010-06-28  No. 405  A Good Meal
2010-06-29  No. 406  Garfield Minus Garfield Plus Garfield's Dialogue
2010-06-30  No. 407  One Over Garfield: 4
2010-07-01  No. 408  Erasure
2010-07-02  No. 409  Remote
2010-07-03  No. 410  Deep Throat Diet Check
2010-07-04  No. 411  Garfield Linus Garfield, Yet Again
2010-07-05  No. 412  Evil Jon
2010-07-06  No. 413  Changefield #3
2010-07-07  No. 414  National World International Fridgeday
2010-07-08  No. 415  Log(Garfield)
2010-07-09  No. 416  Uh-oh, Here Comes Jon
2010-07-10  No. 417  Extinction
2010-07-11  No. 418  Real Horror Show
2010-07-12  No. 419  Garfield Lisa
2010-07-13  No. 420  The Princess Garfield
2010-07-14  No. 421  Garfield Muniz Garfield
2010-07-15  No. 422  Garfield EXTREMELY Minus Garfield, More so Than Ever Before!
2010-07-16  No. 423  Harmony
2010-07-17  No. 424  Garfield Minus G,a,r,f,i,e,l,d
2010-07-18  No. 425  Garfield is Strange
2010-07-19  No. 426  Sense of Scale
2010-07-20  No. 427  Clive
2010-07-21  No. 428  Stripefield
2010-07-22  No. 429  Garfield at the Zoo
2010-07-23  No. 430  Igorfield
2010-07-24  No. 431  Cube of Garfield
2010-07-25  No. 432  Karate
2010-07-26  No. 433  Sin(Garfield)
2010-07-27  No. 434  Garfield Field
2010-07-28  No. 435  Jon Plus Cohen
2010-07-29  No. 436  Garfield sin-1(1)
2010-07-30  No. 437  Nermal, the World's Cutest Kitten!
2010-07-31  No. 438  Garfield Over Zero
2010-08-01  No. 439  Garfield, Infinite Canvas, and The Game of Life, Part I
2010-08-02  No. 440  Garffiti
2010-08-03  No. 441  Garfield Mimas Garfield
2010-08-04  No. 442  Rube Goldfield
2010-08-05  No. 443  Garfield on Facebook
2010-08-06  No. 444  dleifraG
2010-08-07  No. 445  Computer Science: A Garfield Introduction
2010-08-08  No. 446  Sound of Garfield
2010-08-09  No. 447  Garfield as Haikuist
2010-08-10  No. 448  Garfield, Infinite Canvas, and The Game of Life, Part II
2010-08-11  No. 449  Kawaii Garfield
2010-08-12  No. 450  Odie (In the Name of Love)
2010-08-13  No. 451  Garfield Plus Sufferin' Jon
2010-08-14  No. 452  Sorted Garfield
2010-08-15  No. 453  M|A|R|R|F|I|E|L|D
2010-08-16  No. 454  OmahaField
2010-08-17  No. 455  Conway's Game of Garfield
2010-08-18  No. 456  srOMG
2010-08-19  No. 457  Ordered Garfield
2010-08-20  No. 458  Manga Garfield 2 - The End
2010-08-21  No. 459  Communication Failure
2010-08-22  No. 460  Garfield Miley Cyrus Garfield
2010-08-23  No. 461  Lasagna Cat: The Comic
2010-08-24  No. 462  Garfield Plus Beats in the Beat Panel
2010-08-25  No. 463  Monday's Child
2010-08-26  No. 464  Garfield Plus Bill Nye, The Science Guy
2010-08-27  No. 465  Collaborative Cat Skinning
2010-08-28  No. 466  Garfield is Always Watching You
2010-08-29  No. 467  Garfield Minus Absolutely Everything
2010-08-30  No. 468  Un-Kawaii Garfield
2010-08-31  No. 469  Jon in Wonderland
2010-09-01  No. 470  The Dead Future
2010-09-02  No. 471  Garfield Minun Garfield
2010-09-03  No. 472  Yodafield
2010-09-04  No. 473  Arcsin(Garfield)
2010-09-05  No. 474  Garfield Mynas Garfield
2010-09-06  No. 475  Blockland Multiplied by Garfield
2010-09-07  No. 476  Monday Morning Workday Blues
2010-09-08  No. 477  Waiting for Garfield
2010-09-09  No. 478  Garfield [something that sounds a bit like "minus"] Garfield
2010-09-10  No. 479  3-Bit Garfield
2010-09-11  No. 480  Kanine Kamikaze
2010-09-12  No. 481  ガーフィールド
2010-09-13  No. 482  Jon's Horoscope
2010-09-14  No. 483  Imaginary Garfield: Humouring
2010-09-15  No. 484  Spoilerwarningfield
2010-09-16  No. 485  Garfield Minus Fly
2010-09-17  No. 486  Garfield Linus Garfield, Once More With Feeling
2010-09-18  No. 487  Garfield Linus Garfield, Oh What The Heck
2010-09-19  No. 488  Garfield By Numbers
2010-09-20  No. 489  Black shOps
2010-09-21  No. 490  Garfy Peyton's Frying Seacus
2010-09-22  No. 491  Garfield Meme Garfield
2010-09-23  No. 492  Orangutanfield
2010-09-24  No. 493  Recursive Nightmare
2010-09-25  No. 494  Garfield Minus Garfield Minus Jon Plus Doc Boy
2010-09-26  No. 495  Garfield's Birthday
2010-09-27  No. 496  A Message to You, Odie
2010-09-28  No. 497  Garfield Minus Linus Garfield
2010-09-29  No. 498  Blindfolded
2010-09-30  No. 499  Smalltalk
2010-10-01  No. 500  A Garfield Upon the Deep
2010-10-02  No. 501  Garfield Linus Garfield, Et Tu Brute?
2010-10-03  No. 502  Garfield Minus Jon, Plus Dr. Eggman
2010-10-04  No. 503  Garfield Plus Jim Davis' Ego
2010-10-05  No. 504  Lazy Coach
2010-10-06  No. 505  Realist Garfield
2010-10-07  No. 506  Whatever Happened to Lyman?
2010-10-08  No. 507  Jon's Favourite Shirt
2010-10-09  No. 508  Things that Bump Map in the Night
2010-10-10  No. 509  Imaginary Garfield: Bath Time
2010-10-11  No. 510  Garfield Pine Nuts Garfield
2010-10-12  No. 511  Garfield Plus 88 mph
2010-10-13  No. 512  Drugs Will Ruin Your Brain
2010-10-14  No. 513  Garfield (Rescued Chilean) Miners Garfield
2010-10-15  No. 514  Brickfield
2010-10-16  No. 515  Garfield Dies
2010-10-17  No. 516  Garfield Minos Garfield
2010-10-18  No. 517  Jon's Bad Memory
2010-10-19  No. 518  Farmer's Market
2010-10-20  No. 519  More Than One Way to Collaboratively Skin a Cat
2010-10-21  No. 520  Garfield Minix Garfield
2010-10-22  No. 521  Nightmare Fuel Garfield
2010-10-23  No. 522  Garfield plus obfuscated perl code
2010-10-24  No. 523  Melt
2010-10-25  No. 524  Garfield Mines Garfield
2010-10-26  No. 525  Exasperation
2010-10-27  No. 526  Garfield Leaves Garfield
2010-10-28  No. 527  A Ad Fee Floorings Quits Rumor
2010-10-29  No. 528  Garfield CAPTCHA
2010-10-30  No. 529  Garfield Haiku Part 2
2010-10-31  No. 530  The Way of Weigh
2010-11-01  No. 531  Garfield plus obfuscated perl code minus Garfield
2010-11-02  No. 532  ¡Mexicano Garfield!
2010-11-03  No. 533  StinkoGarfield
2010-11-04  No. 534  MS Paint Garfield
2010-11-05  No. 535  Imaginary Garfield: Diet
2010-11-06  No. 536  Animated Jon
2010-11-07  No. 537  Magic with Garfield
2010-11-08  No. 538  Jon Gets Introspective
2010-11-09  No. 539  Garfield Menus Garfield
2010-11-10  No. 540  Garfieldmachine
2010-11-11  No. 541  Frank Miller's All Star Garfield
2010-11-12  No. 542  Mischief
2010-11-13  No. 543  Garfield the Addict (Warning: Contains Drug Reference)
2010-11-14  No. 544  Zalgo Garfield
2010-11-15  No. 545  Chauvinism
2010-11-16  No. 546  Random Fun Garfield
2010-11-17  No. 547  Garfield Linus Arbuckle
2010-11-18  No. 548  Grawfield
2010-11-19  No. 549  The Bayeaux Garfield
2010-11-20  No. 550  Homeopathic Garfield
2010-11-21  No. 551  Garfield Minus Garfield
2010-11-22  No. 552  Butterfield
2010-11-23  No. 553  Disgusting Garfield
2010-11-24  No. 554  Garbert
2010-11-25  No. 555  Imaginary Garfield: Night
2010-11-26  No. 556  Cross-section of Garfield
2010-11-27  No. 557  Eyeballfield
2010-11-28  No. 558  Garfield The Square Root Of Minus Garfield Garfield
2010-11-29  No. 559  Pietfield
2010-11-30  No. 560  One is a Genius, the Other's Insane
2010-12-01  No. 561  Fork in the Road!
2010-12-02  No. 562  Garfield Miners Garfield, take 2
2010-12-03  No. 563  Gustaf som Gustaf
2010-12-04  No. 564  Changefield #4: Genesis
2010-12-05  No. 565  Colonel Beltfield
2010-12-06  No. 566  Wither, Garfield?
2010-12-07  No. 567  Garfield Happily Lost in Translation (Japanese)
2010-12-08  No. 568  Interactive Garfield
2010-12-09  No. 569  Optical Illusion Garfield
2010-12-10  No. 570  Garfield Iris Garfield
2010-12-11  No. 571  Dream Me a Dream
2010-12-12  No. 572  Imaginary Garfield: Warmth
2010-12-13  No. 573  Christmas Lights
2010-12-14  No. 574  Dleifrag Sunim Dleifrag
2010-12-15  No. 575  Love Letters
2010-12-16  No. 576  Garfield Minus Sarcasm
2010-12-17  No. 577  They Just Won't Stop!
2010-12-18  No. 578  Zalgo Garfield 2
2010-12-19  No. 579  Basic Mathematics
2010-12-20  No. 580  Yes, Garfield, That's Exactly What They Did
2010-12-21  No. 581  End of the Worldfield
2010-12-22  No. 582  Vuvuzela Garfield
2010-12-23  No. 583  Monday, 2 Years Later
2010-12-24  No. 584  No Hug
2010-12-25  No. 585  It's the Thought That Counts
2010-12-26  No. 586  Garfield Dromiceiomimus Garfield
2010-12-27  No. 587  Blind Sided
2010-12-28  No. 588  Scale
2010-12-29  No. 589  The Dark Side of The Cookie
2010-12-30  No. 590  Townshend Garfield Townshend
2010-12-31  No. 591  f-1(Jon)
2011-01-01  No. 592  Gustaf som Gustaf: Something Fishy
2011-01-02  No. 593  Garkenstein
2011-01-03  No. 594  Garfield (St.) Linus Garfield
2011-01-04  No. 595  Garfield Gets the Food
2011-01-05  No. 596  Garfield the Narcissist
2011-01-06  No. 597  Spider
2011-01-07  No. 598  Garfield, His Royal Highness, Garfield
2011-01-08  No. 599  I Can Hear You
2011-01-09  No. 600  Square Root of Minus Heathcliff
2011-01-10  No. 601  Outfield
2011-01-11  No. 602  Strong Coffee
2011-01-12  No. 603  Garfield Minesweeper Garfield
2011-01-13  No. 604  Garfield Plus Jon Plus Jon Plus Jon
2011-01-14  No. 605  Mr Grumpy
2011-01-15  No. 606  Miscommunication
2011-01-16  No. 607  Another Garfield Minus Garfield (Minus Odie)
2011-01-17  No. 608  Karvinen
2011-01-18  No. 609  Amoeba-Man
2011-01-19  No. 610  Random No Sundays
2011-01-20  No. 611  Garfield Minuet Garfield
2011-01-21  No. 612  Jon's Punishment
2011-01-22  No. 613  Constantly Changing
2011-01-23  No. 614  Garfield Garfield Garfield
2011-01-24  No. 615  The Great Gatsfield
2011-01-25  No. 616  A New Punchline
2011-01-26  No. 617  Orange Cat Exchange Program
2011-01-27  No. 618  Garfield My Nose Garfield
2011-01-28  No. 619  Garf At Your Own Joke
2011-01-29  No. 620  Garfield Lines Garfield
2011-01-30  No. 621  Garfield Manus Garfield
2011-01-31  No. 622  Garfield Swinub Garfield
2011-02-01  No. 623  Garfield Mimes Garfield
2011-02-02  No. 624  Garfield Springsteen Garfield
2011-02-03  No. 625  Garfield Skynet Garfield: Judgment Day
2011-02-04  No. 626  Garfheid
2011-02-05  No. 627  Garfield Minus Any Kind Of Artistic Talent
2011-02-06  No. 628  Garfield on Cable TV
2011-02-07  No. 629  Percentiles of Garfield: 2009
2011-02-08  No. 630  Dinosaur Garfield
2011-02-09  No. 631  Liz
2011-02-10  No. 632  Richard Garfield
2011-02-11  No. 633  Percentiles of Square Root of Minus Garfield
2011-02-12  No. 634  Garfield Plus Jon
2011-02-13  No. 635  Garfield Minus Liz
2011-02-14  No. 636  Hermanfield
2011-02-15  No. 637  Doc as Doc
2011-02-16  No. 638  Racine carrée de Garfield moins
2011-02-17  No. 639  Modes of Garfield: 1978-2010
2011-02-18  No. 640  We Don't Speak Cat
2011-02-19  No. 641  ¡Garfield Mexicano, La Versión Mejorada!
2011-02-20  No. 642  The Pacifist Cat
2011-02-21  No. 643  Bored
2011-02-22  No. 644  Garfield Minus Controversy
2011-02-23  No. 645  Cloak of Garfield Impersonation FAIL
2011-02-24  No. 646  Cold Call
2011-02-25  No. 647  Garfield Plus High Art Minus Good Taste
2011-02-26  No. 648  Jon's Terrible, Horrible, No Good, Very Bad Day
2011-02-27  No. 649  Garfield QR Code
2011-02-28  No. 650  Odie's Secret to Happiness
2011-03-01  No. 651  The Sinister Mind of Odie Arbuckle
2011-03-02  No. 652  Conway's Game of Death
2011-03-03  No. 653  Googley-eyed Garfield, Extended Version
2011-03-04  No. 654  Splut!
2011-03-05  No. 655  Ennuifield
2011-03-06  No. 656  Veterans/Memorial Day Garfield
2011-03-07  No. 657  "Garfield Minus Garfield" Plus Garfield
2011-03-08  No. 658  Shipping
2011-03-09  No. 659  International Klein Blue Garfield
2011-03-10  No. 660  Frankenstein's Garfield
2011-03-11  No. 661  Simon
2011-03-12  No. 662  Grinfield II
2011-03-13  No. 663  A Human Woman
2011-03-14  No. 664  Garfbert
2011-03-15  No. 665  Lean on Me
2011-03-16  No. 666  3:16
2011-03-17  No. 667  Honeysuckle Garfield
2011-03-18  No. 668  Garfield Minus Two Panels
2011-03-19  No. 669  Birthdays
2011-03-20  No. 670  Spell-checked Garfield
2011-03-21  No. 671  Burrows-Wheeler transformed Garfield
2011-03-22  No. 672  Dismal February
2011-03-23  No. 673  Garfield!
2011-03-24  No. 674  Marvel-field
2011-03-25  No. 675  Jon and Lyman #1: How it began
2011-03-26  No. 676  Reversed Punchline Garfield
2011-03-27  No. 677  Random Garfield Collection
2011-03-28  No. 678  Student Garfield
2011-03-29  No. 679  A Square Root of Minus Garfield
2011-03-30  No. 680  Garfield, Supported by Keyboard Cat
2011-03-31  No. 681  The Lone Hamburger
2011-04-01  No. 682  European Nermal
2011-04-02  No. 683  Grinfield III
2011-04-03  No. 684  It's A Slippery Slope Garfield Minus Garfield
2011-04-04  No. 685  Natural Log of Garfield
2011-04-05  No. 686  Garfield Gets Fuzzy
2011-04-06  No. 687  Garfield plus Brevity(?)
2011-04-07  No. 688  Jon's New Cologne
2011-04-08  No. 689  How to Get Jon Arrested
2011-04-09  No. 690  Wilhelm Scream-field: A Day in the Life
2011-04-10  No. 691  Burrows-Wheeler transformed Garfield II: Pixels
2011-04-11  No. 692  Jon's Birthday
2011-04-12  No. 693  Garfield in Reverse is Good
2011-04-13  No. 694  Jon and Lyman #2: Movie?
2011-04-14  No. 695  Garfield vs. Garfield
2011-04-15  No. 696  Colour-Averaged Garfield: January 2007
2011-04-16  No. 697  Abu Ghraibfield
2011-04-17  No. 698  Square Food of My Nice Garfield
2011-04-18  No. 699  Learfield
2011-04-19  No. 700  We Needed Some Change
2011-04-20  No. 701  Garfield in Red
2011-04-21  No. 702  Garfield Minus Oxygen
2011-04-22  No. 703  Hacked Off
2011-04-23  No. 704  Mission Statement
2011-04-24  No. 705  Hockey Theme
2011-04-25  No. 706  Jon and Lyman #3: Movie
2011-04-26  No. 707  Not a Without My Cake
2011-04-27  No. 708  Gravity Switch
2011-04-28  No. 709  Beware of Cat
2011-04-29  No. 710  Texture Quilted Garfield
2011-04-30  No. 711  Violating the Geneva Convention
2011-05-01  No. 712  Don't look at me before I have my morning coffee
2011-05-02  No. 713  Garfield Abridged
2011-05-03  No. 714  Garfield Minus Any Kind Of Artistic Talent Two
2011-05-04  No. 715  Pay Attention
2011-05-05  No. 716  Jon and Lyman #4: The roll
2011-05-06  No. 717  Garfield - Garfield = SKYNET
2011-05-07  No. 718  Enemy Party
2011-05-08  No. 719  Garfield Chamberlain Garfield
2011-05-09  No. 720  The Fly, Part I
2011-05-10  No. 721  Garfield Plagiarises Peanuts
2011-05-11  No. 722  Found by: Zalgo
2011-05-12  No. 723  Garfield Inverse Garfield
2011-05-13  No. 724  Kill Liz
2011-05-14  No. 725  Homicidal Garfield
2011-05-15  No. 726  Jim Davis's Breakdown
2011-05-16  No. 727  Garfield of Theseus
2011-05-17  No. 728  Clowns
2011-05-18  No. 729  Garfield le Chat
2011-05-19  No. 730  The Fly, Part II
2011-05-20  No. 731  Jon Gets a Date
2011-05-21  No. 732  Garfield Fortress 2
2011-05-22  No. 733  Badly Translated Garfield
2011-05-23  No. 734  Funky Winkerfield
2011-05-24  No. 735  Square Root of Garfield Multiplied by B.C.
2011-05-25  No. 736  Garfoot
2011-05-26  No. 737  Woo Woo Woo!
2011-05-27  No. 738  Jon and Lyman #5: Scary TV show
2011-05-28  No. 739  Coffee!
2011-05-29  No. 740  Garfield Minus European Ancestry
2011-05-30  No. 741  The Inverse of Negative Garfield Squared
2011-05-31  No. 742  Dilbfield
2011-06-01  No. 743  Garfield Goes Green
2011-06-02  No. 744  Garfield Plagiarises Peanuts - Again
2011-06-03  No. 745  Jon Uncovered
2011-06-04  No. 746  Silent Jon
2011-06-05  No. 747  Chaotic Garfield
2011-06-06  No. 748  A New Angle
2011-06-07  No. 749  Manga Garfield 3: Black Humour
2011-06-08  No. 750  Jon and Lyman #6: Scary Newspaper (or Vengeance)
2011-06-09  No. 751  Loneliness
2011-06-10  No. 752  Garfield in Plaid
2011-06-11  No. 753  Missing Setup
2011-06-12  No. 754  Less Story, More Humour
2011-06-13  No. 755  Comic in a Blender
2011-06-14  No. 756  Garfield Minus Cooking
2011-06-15  No. 757  Jon Arbuckle 2001 Random Montage
2011-06-16  No. 758  Lyman Rieserv
2011-06-17  No. 759  Actually Chaotic Garfield
2011-06-18  No. 760  Jon and Lyman #7: How it ended
2011-06-19  No. 761  None so Blind as Who Won't See
2011-06-20  No. 762  A Small World
2011-06-21  No. 763  Out of Character Garfield
2011-06-22  No. 764  Smile.cat
2011-06-23  No. 765  Jon the Angry Flower
2011-06-24  No. 766  Wordlefield
2011-06-25  No. 767  Changefield #5: Fern Comics
2011-06-26  No. 768  Yecch!
2011-06-27  No. 769  The Lyman Bones
2011-06-28  No. 770  Garfield Stanton Friedman Garfield
2011-06-29  No. 771  Blame
2011-06-30  No. 772  Garfield = Mass Times Acceleration
2011-07-01  No. 773  Centrefurld
2011-07-02  No. 774  Blender Reblended
2011-07-03  No. 775  Life on MarsField
2011-07-04  No. 776  Leanfield
2011-07-05  No. 777  Blend with Glue
2011-07-06  No. 778  Our Cow Runneth Over
2011-07-07  No. 779  Making Garfield Slightly Worse
2011-07-08  No. 780  Killing Lyman
2011-07-09  No. 781  Plunged
2011-07-10  No. 782  Two-Eyed Man is King of the Blind
2011-07-11  No. 783  Blending the Fourth Wall
2011-07-12  No. 784  Centrefold, Updated
2011-07-13  No. 785  Turgarfieldkey
2011-07-14  No. 786  Transplanted Punchline Garfield
2011-07-15  No. 787  Jon Minus Companionship
2011-07-16  No. 788  Blame II
2011-07-17  No. 789  Cthulhu Dreamin'
2011-07-18  No. 790  Garfield Plus Penultimate Lengthened Gutter
2011-07-19  No. 791  Blender Mystery
2011-07-20  No. 792  West End Garfield
2011-07-21  No. 793  Twelve-Year Turbulence
2011-07-22  No. 794  Clone
2011-07-23  No. 795  Garfield Cubed
2011-07-24  No. 796  Minefield
2011-07-25  No. 797  Garfield Minus Pudding Pops
2011-07-26  No. 798  Four Panel Garfield
2011-07-27  No. 799  Dear Diary
2011-07-28  No. 800  Garfield Hypercubed
2011-07-29  No. 801  Garfield, Scorcese Style
2011-07-30  No. 802  Less Chaotic Garfield
2011-07-31  No. 803  Stuck
2011-08-01  No. 804  Fern Comics 2
2011-08-02  No. 805  Garfy Cat
2011-08-03  No. 806  Scunthorpe Garfield
2011-08-04  No. 807  Garfield Plus Meme
2011-08-05  No. 808  Cham-Pain
2011-08-06  No. 809  Let Sleeping Cats Lie
2011-08-07  No. 810  Murderous Jon
2011-08-08  No. 811  Minefield #2
2011-08-09  No. 812  Self-advertisement
2011-08-10  No. 813  Babelfishfield
2011-08-11  No. 814  Joy!
2011-08-12  No. 815  Garfield Plus Terminator
2011-08-13  No. 816  Jon's Revenge
2011-08-14  No. 817  Blender, from New York, it's Saturday Night!
2011-08-15  No. 818  Jumpy Cat
2011-08-16  No. 819  Mirror Universe Garfield
2011-08-17  No. 820  A Blend of Change
2011-08-18  No. 821  Minefield #3
2011-08-19  No. 822  NESField 2 (Final Fantasy - Garland + Garfield)
2011-08-20  No. 823  Cerebus Meets Garfield
2011-08-21  No. 824  Cat Food
2011-08-22  No. 825  Garfield Plus Circumstantial Evidence
2011-08-23  No. 826  Garfield's Theatres
2011-08-24  No. 827  Garfield Word Cloud
2011-08-25  No. 828  Invisifield and the Pudding Cup
2011-08-26  No. 829  Garfield, Starring Jon Cryer
2011-08-27  No. 830  Garfield Bookplug Garfield
2011-08-28  No. 831  Nightmare Minus Garfield (and Odie)
2011-08-29  No. 832  Garfield Plus Old Age
2011-08-30  No. 833  Can You Draw Me?
2011-08-31  No. 834  Redactedfield
2011-09-01  No. 835  Garfield Minus Garfield Plus Pickles
2011-09-02  No. 836  I could tell at once that you were a bender
2011-09-03  No. 837  Minefield #4
2011-09-04  No. 838  Guiso de Carne
2011-09-05  No. 839  Overly Long Walk
2011-09-06  No. 840  Of Mice and Garfield
2011-09-07  No. 841  Positive Garfield
2011-09-08  No. 842  Wallpaper
2011-09-09  No. 843  Steakfield
2011-09-10  No. 844  Garfield Routine
2011-09-11  No. 845  Garfield as a Penguin
2011-09-12  No. 846  The Day Before Garfield Got Cancelled
2011-09-13  No. 847  First We Take Manhattan...
2011-09-14  No. 848  Swiss Army Knife
2011-09-15  No. 849  Square Root of Minus Garfield's Hue
2011-09-16  No. 850  Present 4 Nermal
2011-09-17  No. 851  Jon's World
2011-09-18  No. 852  Tulip Tiptoe
2011-09-19  No. 853  Oops
2011-09-20  No. 854  Nose Pencils
2011-09-21  No. 855  Transplanted Punchline Garfield Plus Penultimate Beat Panel (Fun With Penultimate Beat Panel #1)
2011-09-22  No. 856  Tragedy
2011-09-23  No. 857  Gayfield
2011-09-24  No. 858  Garfield With Even More Inappropriate Sound Effect
2011-09-25  No. 859  Limerickfield
2011-09-26  No. 860  Garfield Photonovel
2011-09-27  No. 861  I Dreamed a Dream
2011-09-28  No. 862  Garfield Didn't Know
2011-09-29  No. 863  Meme Blender
2011-09-30  No. 864  C n s n nt f ld
2011-10-01  No. 865  Hypno
2011-10-02  No. 866  Minefield #5
2011-10-03  No. 867  Garfield's Error Theatre
2011-10-04  No. 868  Most Accidents Happen In The Home
2011-10-05  No. 869  Garfmeme^2
2011-10-06  No. 870  Leaf Grid
2011-10-07  No. 871  Beware of Apteryx
2011-10-08  No. 872  Garfield minus G@rf131d
2011-10-09  No. 873  Pity about the rest
2011-10-10  No. 874  The only way Garfield will ever eat a mouse
2011-10-11  No. 875  Arugulafield
2011-10-12  No. 876  My Little Garfield
2011-10-13  No. 877  Garfield's Dog Day
2011-10-14  No. 878  Grew
2011-10-15  No. 879  Garfield Minus Garfield Plus John Garfield
2011-10-16  No. 880  Sadisticfield
2011-10-17  No. 881  Garfield Plus Futurama
2011-10-18  No. 882  Blender v2.5
2011-10-19  No. 883  Inverfield
2011-10-20  No. 884  Dewey Readmore Books
2011-10-21  No. 885  Square Root of Minus Garfield's Hue 2
2011-10-22  No. 886  Kierkegaarfield
2011-10-23  No. 887  Complex Square Root of Minus Garfield
2011-10-24  No. 888  Strange Neighbourhood
2011-10-25  No. 889  The Cat Who Saw Everything Twice
2011-10-26  No. 890  Spot The Difference With Garfield
2011-10-27  No. 891  More Nose Pencils
2011-10-28  No. 892  Transplanted Sight Gag Garfield Plus Penultimate Beat Panel (Fun With Penultimate Beat Panel #2)
2011-10-29  No. 893  Heavy Package
2011-10-30  No. 894  Potty Humour
2011-10-31  No. 895  Sunday Minefield Sunday
2011-11-01  No. 896  Toil
2011-11-02  No. 897  Splash
2011-11-03  No. 898  Kierkegaarfield 2
2011-11-04  No. 899  Garfa-Shave
2011-11-05  No. 900  Freedom's Waiting, Part 1
2011-11-06  No. 901  Memes are Constantly Changing
2011-11-07  No. 902  Spot The Difference With Garfield 2
2011-11-08  No. 903  Mystery Garfield Theater 3000
2011-11-09  No. 904  Garfield's Error Theatre #2
2011-11-10  No. 905  Butterfield
2011-11-11  No. 906  Garfield Doors
2011-11-12  No. 907  Garfield Minus 2/3 Garfield, Minus Borders
2011-11-13  No. 908  Garfield's Orrery Theater
2011-11-14  No. 909  Patterns that Repeat
2011-11-15  No. 910  Making Garfield Slightly Worse Via Penultimate Beat Panel (Fun With Penultimate Beat Panel #3)
2011-11-16  No. 911  Uh Oh, Here Comes Jon 2
2011-11-17  No. 912  Bearly Funny
2011-11-18  No. 913  Snowman Power
2011-11-19  No. 914  Yawn - Bat
2011-11-20  No. 915  Splash Splash
2011-11-21  No. 916  Bronyfield
2011-11-22  No. 917  Ordinary Blender
2011-11-23  No. 918  Garfield Minus Garfield Plus Pooky
2011-11-24  No. 919  Garfield Plus Willpower
2011-11-25  No. 920  Freedom's Waiting, Part 2
2011-11-26  No. 921  Escalators
2011-11-27  No. 922  Does it Blend?
2011-11-28  No. 923  It's the old Garfield gag
2011-11-29  No. 924  Crossfield
2011-11-30  No. 925  Garfield the Wizard
2011-12-01  No. 926  Jon Gets on With Life
2011-12-02  No. 927  Dog of a Thousand Faces
2011-12-03  No. 928  Garfield Minus Garfield Cubed
2011-12-04  No. 929  Orson and Friends
2011-12-05  No. 930  Constance Garnett
2011-12-06  No. 931  Garfield Plus Garfield Plus Garfield
2011-12-07  No. 932  Garfield plus Updated Palaeontology
2011-12-08  No. 933  Garf-Bit Theater
2011-12-09  No. 934  Suicide Bomber Garfield
2011-12-10  No. 935  Garfield plus Transplanted Dialogue
2011-12-11  No. 936  Gurfaild
2011-12-12  No. 937  Less is More
2011-12-13  No. 938  U.S. Acres Plus Spontaneous Garfield
2011-12-14  No. 939  Garfield's Hoarder Theatre
2011-12-15  No. 940  The Gift of Embarassing Clairvoyance
2011-12-16  No. 941  The Very Last Garfield Minus Garfield Strip
2011-12-17  No. 942  Batmanfield
2011-12-18  No. 943  Spoot!
2011-12-19  No. 944  Two Words from Our Sponsors
2011-12-20  No. 945  In which Jon has glued a frozen pudding pop to his face
2011-12-21  No. 946  One Panel Garfield
2011-12-22  No. 947  Dull and Repetitive
2011-12-23  No. 948  Goatfield
2011-12-24  No. 949  Gerald Scarfield
2011-12-25  No. 950  Christmasfield
2011-12-26  No. 951  Turkey-Flavoured Blend
2011-12-27  No. 952  Dog of a Thousand Faces v.2
2011-12-28  No. 953  Garfield Bizarro Minus Garfield
2011-12-29  No. 954  Back To The Beginning
2011-12-30  No. 955  A Word from Paws, Inc.
2011-12-31  No. 956  Social Learning Garfield
2012-01-01  No. 957  What the Spider Saw
2012-01-02  No. 958  Edward Goreyfield
2012-01-03  No. 959  The Twenty-Nine Year Reflection
2012-01-04  No. 960  Gluefield #443
2012-01-05  No. 961  Geocached Garfield
2012-01-06  No. 962  Punchline collation
2012-01-07  No. 963  Jon's New Outfit
2012-01-08  No. 964  SLURRP!
2012-01-09  No. 965  Hospital Hallucination
2012-01-10  No. 966  Pan of Lasagna
2012-01-11  No. 967  Loud Commercial
2012-01-12  No. 968  Spell Check
2012-01-13  No. 969  Garfield Minus (Garfield Plus Jon)
2012-01-14  No. 970  Lady of Spain
2012-01-15  No. 971  The Day After the Meme
2012-01-16  No. 972  Jon Bieber
2012-01-17  No. 973  Large Petshop of Horrors
2012-01-18  No. 974  Gamefield
2012-01-19  No. 975  Garfield's Poetry Theatre
2012-01-20  No. 976  Fun With Auxiliary Verbs
2012-01-21  No. 977  Talk
2012-01-22  No. 978  Penultimate Beat Panel ×2 (Fun With Penultimate Beat Panel #4)
2012-01-23  No. 979  Lostfield
2012-01-24  No. 980  Garfield Plus Even Better Updated Palaeontology
2012-01-25  No. 981  Torch of Garfield
2012-01-26  No. 982  Background Blender
2012-01-27  No. 983  The colourist - unaware or more aware than us all?
2012-01-28  No. 984  Simon and Garfield
2012-01-29  No. 985  Garfield Times GARFIELD
2012-01-30  No. 986  My Little Garfield 2
2012-01-31  No. 987  Garfield plus Updated Palynology
2012-02-01  No. 988  Spider Hair
2012-02-02  No. 989  Garfield's New Catchphrase
2012-02-03  No. 990  Garfield's Horror Heater
2012-02-04  No. 991  Swedish Chefield
2012-02-05  No. 992  Paging Santa
2012-02-06  No. 993  Garfield Kills Hitler
2012-02-07  No. 994  Garfield vs. Laser
2012-02-08  No. 995  Swanfield
2012-02-09  No. 996  Garfield Plus Cthulhoo = Garfield Minus Garfield
2012-02-10  No. 997  Garfield Dies 3
2012-02-11  No. 998  Horror Theatre: Blender Pudding Pops!
2012-02-12  No. 999  The Physical Impossibility of Garfield in the Mind of Someone Living
2012-02-13  No. 1000  1000th Root of Minus Garfield
2012-02-14  No. 1001  Party Like it's #999
2012-02-15  No. 1002  Garfachu #1
2012-02-16  No. 1003  Genre Savvy Garfield
2012-02-17  No. 1004  Garfield Plus Seriousness
2012-02-18  No. 1005  IWWfield
2012-02-19  No. 1006  NES Garkenstein
2012-02-20  No. 1007  Invisible Jon
2012-02-21  No. 1008  Garfo Marx
2012-02-22  No. 1009  Garfield Plus Superlatively Updated Palaeontology
2012-02-23  No. 1010  Lyman Minus Lyman
2012-02-24  No. 1011  Subverted Trope
2012-02-25  No. 1012  Beedlefield
2012-02-26  No. 1013  The Clean Shirt
2012-02-27  No. 1014  Plagiarism
2012-02-28  No. 1015  A Bet
2012-02-29  No. 1016  Beware of CATS
2012-03-01  No. 1017  Freaky Jon
2012-03-02  No. 1018  Cut and Paste Comic
2012-03-03  No. 1019  Penguin Turns the Table
2012-03-04  No. 1020  Jon Minus Blender
2012-03-05  No. 1021  Sir Nicholas Serota Makes a Syndication Decision
2012-03-06  No. 1022  Tilable Garfield
2012-03-07  No. 1023  Pokémon Speak
2012-03-08  No. 1024  Garfield Minus Garfield Plus Casper
2012-03-09  No. 1025  Garfield Plagiarises Peanuts - Yet Again
2012-03-10  No. 1026  Are You My Mummy?
2012-03-11  No. 1027  Starfield
2012-03-12  No. 1028  Seven More No Sundays
2012-03-13  No. 1029  Mirror Garfield
2012-03-14  No. 1030  Out of Order
2012-03-15  No. 1031  Garfield's Fantasy Theatre
2012-03-16  No. 1032  Into The Background
2012-03-17  No. 1033  Garfield Candy
2012-03-18  No. 1034  Jaggerfield
2012-03-19  No. 1035  Smile
2012-03-20  No. 1036  Changefield #6: Amazing World Of Garfield
2012-03-21  No. 1037  She Makes Me Wanna Garfield
2012-03-22  No. 1038  Excuuuuuuuuse Me, Garfield
2012-03-23  No. 1039  Ionfield
2012-03-24  No. 1040  About Time
2012-03-25  No. 1041  Pooch Cafield
2012-03-26  No. 1042  Garfield's Corer Theatre
2012-03-27  No. 1043  Elephant Talk
2012-03-28  No. 1044  Kiss Transfer
2012-03-29  No. 1045  The First Thing You Said
2012-03-30  No. 1046  Continuity Fixed Garfield
2012-03-31  No. 1047  Garfield Minus Garfield Plus Catface
2012-04-01  No. 1048  Garflare
2012-04-02  No. 1049  Garfield's Meme Theatre
2012-04-03  No. 1050  Garfield Plus Censored Violence
2012-04-04  No. 1051  Second Opinion
2012-04-05  No. 1052  Sock Puppet Minus Garfield
2012-04-06  No. 1053  Calvin And Garfield
2012-04-07  No. 1054  Gar-Lightfield
2012-04-08  No. 1055  Blender 3D
2012-04-09  No. 1056  Pony Friends
2012-04-10  No. 1057  Bunfield
2012-04-11  No. 1058  Wordpadfield
2012-04-12  No. 1059  Loraxfield
2012-04-13  No. 1060  Joni Arbuckle
2012-04-14  No. 1061  Art as Garfield as Art
2012-04-15  No. 1062  Jon, Creative?
2012-04-16  No. 1063  An American Tale
2012-04-17  No. 1064  Square Root of Minus Garfield
2012-04-18  No. 1065  Garfield's Blunder Theatre
2012-04-19  No. 1066  Wallfield
2012-04-20  No. 1067  Barfield, Sunday Edition
2012-04-21  No. 1068  The Sixth Day
2012-04-22  No. 1069  Fall of Flies
2012-04-23  No. 1070  Fridge Climb
2012-04-24  No. 1071  Unbelievable
2012-04-25  No. 1072  Famous First Words
2012-04-26  No. 1073  Derpyfield
2012-04-27  No. 1074  Garfield Minus Panel Boundaries
2012-04-28  No. 1075  Then, After That...
2012-04-29  No. 1076  Brickfield 2
2012-04-30  No. 1077  36×10 Garfield 2
2012-05-01  No. 1078  Six-Fingered Man
2012-05-02  No. 1079  Garfield Garfield Meta-Garfield
2012-05-03  No. 1080  If on a summer's night a cartoonist
2012-05-04  No. 1081  Garfield Gets It Backwards
2012-05-05  No. 1082  Today, the World...
2012-05-06  No. 1083  Garfield Before Swine
2012-05-07  No. 1084  Garfield Plus Crazy Frog
2012-05-08  No. 1085  Garfield Defends Good Music
2012-05-09  No. 1086  The Ugly Garfield
2012-05-10  No. 1087  Know Your Rights
2012-05-11  No. 1088  No Bleep, Sherlock... er Garfield
2012-05-12  No. 1089  Life Minus Pudding Pops
2012-05-13  No. 1090  A Birthday Tradition
2012-05-14  No. 1091  Like Colour to the Blind
2012-05-15  No. 1092  How do you like them petunias?
2012-05-16  No. 1093  Team Garfield 2
2012-05-17  No. 1094  Coffee Kills
2012-05-18  No. 1095  Garfield & I in a little toy shop
2012-05-19  No. 1096  Meet the Garfheads
2012-05-20  No. 1097  What Happened in the February 22, 1981, Comic Strip
2012-05-21  No. 1098  Hit Dog
2012-05-22  No. 1099  Prevue Garfied
2012-05-23  No. 1100  Attack of the Memes
2012-05-24  No. 1101  Drawrof
2012-05-25  No. 1102  Randomiser
2012-05-26  No. 1103  Pingasfield
2012-05-27  No. 1104  2field
2012-05-28  No. 1105  Meet the Garfheads 2
2012-05-29  No. 1106  D'oh, Nuts!
2012-05-30  No. 1107  Gallusfield
2012-05-31  No. 1108  Express Yourself
2012-06-01  No. 1109  Burgerfield
2012-06-02  No. 1110  Hobby Attire
2012-06-03  No. 1111  Scarred for Life
2012-06-04  No. 1112  The Sinister Mind of Odie Arbuckle, pt 2
2012-06-05  No. 1113  No Breathing
2012-06-06  No. 1114  Coffee Kills 2
2012-06-07  No. 1115  Weegeefield
2012-06-08  No. 1116  Interrupted Satellite Signal Garfield
2012-06-09  No. 1117  'Lawsey' Explained
2012-06-10  No. 1118  Jon's Twilight Saga
2012-06-11  No. 1119  Garfield with Nouns Replaced With "Cat"
2012-06-12  No. 1120  Double Date
2012-06-13  No. 1121  Uncomfortable Truth Garfield
2012-06-14  No. 1122  Poo
2012-06-15  No. 1123  Eek!
2012-06-16  No. 1124  I Ain't Got Nobody
2012-06-17  No. 1125  3×2field
2012-06-18  No. 1126  Advanced Blender
2012-06-19  No. 1127  Happy Birthday, Garfield a.k.a. Garfield's Hidden Object Game
2012-06-20  No. 1128  Fanon
2012-06-21  No. 1129  Garfield Plus Red Eye Remover
2012-06-22  No. 1130  Ahaafield
2012-06-23  No. 1131  Garfield's Hallucinations (Warning: contains drug reference)
2012-06-24  No. 1132  Incomplete Garfield
2012-06-25  No. 1133  Square Root of Mezzacotta
2012-06-26  No. 1134  GARF
2012-06-27  No. 1135  Wagner's Ringtone
2012-06-28  No. 1136  Mighty Thor
2012-06-29  No. 1137  Garfield the Fantastic
2012-06-30  No. 1138  Cute Things Exploding - Nermal
2012-07-01  No. 1139  Sliding Doorsfield
2012-07-02  No. 1140  Honkexp
2012-07-03  No. 1141  Longevity
2012-07-04  No. 1142  Frozen Pudding Pops Ringtone, Smashed!
2012-07-05  No. 1143  Bitshiftfield
2012-07-06  No. 1144  Lipogrammatic Pumpkin-and-Black Cat
2012-07-07  No. 1145  (Licki)tung
2012-07-08  No. 1146  Flamethrower
2012-07-09  No. 1147  Garfield's Crap Past the Radar Theatre
2012-07-10  No. 1148  Truth-Enhanced Garfield
2012-07-11  No. 1149  Garfield's Point of View
2012-07-12  No. 1150  Who Killed Garfield Palmer?
2012-07-13  No. 1151  Mystery Food
2012-07-14  No. 1152  It.
2012-07-15  No. 1153  Square Root of (Literal) Minus Garfield
2012-07-16  No. 1154  The Entertainer
2012-07-17  No. 1155  Computer Garfield
2012-07-18  No. 1156  Game Boy Garfield
2012-07-19  No. 1157  Jon Learns Something Online
2012-07-20  No. 1158  Family Garfield
2012-07-21  No. 1159  Another Garfield Minus Garfield - Value Added
2012-07-22  No. 1160  Liar, Liar, Pants on Fire
2012-07-23  No. 1161  Draw Some Garfield
2012-07-24  No. 1162  Garfield Retold Retold Retold
2012-07-25  No. 1163  Garfield Retold's Retelling Retold
2012-07-26  No. 1164  Barneyfield
2012-07-27  No. 1165  Arrrfield
2012-07-28  No. 1166  Jon Forgot Lasagna Thursday Twice
2012-07-29  No. 1167  Metajoke Garfield
2012-07-30  No. 1168  Who Killed Garfield Palmer? Part 2
2012-07-31  No. 1169  Jon as an Ant
2012-08-01  No. 1170  Updates
2012-08-02  No. 1171  Lunafield
2012-08-03  No. 1172  You're Gonna Lose That Garfield
2012-08-04  No. 1173  In Your Ear
2012-08-05  No. 1174  Metamorfield
2012-08-06  No. 1175  Una traducción al español de la primera tira de Garfield cómic, que data del 19 de junio 1978
2012-08-07  No. 1176  The Murderous Dog
2012-08-08  No. 1177  Ambigrammatical Garfield
2012-08-09  No. 1178  Draw Me
2012-08-10  No. 1179  Obvious Crossover (Hägar the Horrible)
2012-08-11  No. 1180  Vikingfield
2012-08-12  No. 1181  Square Root of Minecraft Garfield
2012-08-13  No. 1182  Dead Body
2012-08-14  No. 1183  Garfield's Silent Theatre
2012-08-15  No. 1184  Old and Inferior
2012-08-16  No. 1185  The Latin Root of Minus Garfield
2012-08-17  No. 1186  Manga Nermal
2012-08-18  No. 1187  Plus chat change, plus c'est la męme chose
2012-08-19  No. 1188  Y Combinator Garfield
2012-08-20  No. 1189  Minus Garfield Reversed
2012-08-21  No. 1190  Joy and Horror
2012-08-22  No. 1191  Bryan Adams-field
2012-08-23  No. 1192  Screaming Minus Garfield
2012-08-24  No. 1193  Garfield Minus Phone
2012-08-25  No. 1194  Spot The Difference With Garfield 3
2012-08-26  No. 1195  No Questions Asked
2012-08-27  No. 1196  Anonyfield
2012-08-28  No. 1197  LOGIC
2012-08-29  No. 1198  Comments on a Garfield Postcard
2012-08-30  No. 1199  Garfield's Character
2012-08-31  No. 1200  Garfield Linguam Latinam Loquitur
2012-09-01  No. 1201  Garfield Minus Any Kind of Artistic Talent 3
2012-09-02  No. 1202  Garfield Limited Special Collector's Ultimate Edition
2012-09-03  No. 1203  Daft Punk-field
2012-09-04  No. 1204  The Times They Are-a Changin'
2012-09-05  No. 1205  Does Anyone Really Know What Time It Is, Garfield?
2012-09-06  No. 1206  Rare Sentence Garfield
2012-09-07  No. 1207  Sardi's this Ain't
2012-09-08  No. 1208  Horror Theatre: Jon, the Blender Prophet, episode 2
2012-09-09  No. 1209  The Sad, Lonely Journey of a Garfield Comic Strip
2012-09-10  No. 1210  De-Fence
2012-09-11  No. 1211  Happy Birthday, Sucker
2012-09-12  No. 1212  Big Society Garfield
2012-09-13  No. 1213  Square Root of Minecraft Garfield Minus Garfield
2012-09-14  No. 1214  Garfield Minus Mice
2012-09-15  No. 1215  Constantly Changing V2.0
2012-09-16  No. 1216  Tracheostofield
2012-09-17  No. 1217  Dog-Eating Treets
2012-09-18  No. 1218  Garfield Retelling Clarified
2012-09-19  No. 1219  Retold Retelling of Garfield Retold's Retelling
2012-09-20  No. 1220  Square Root of Minus eBay
2012-09-21  No. 1221  Poorly Received Garfield
2012-09-22  No. 1222  Separation
2012-09-23  No. 1223  Dark Side of the Lasagne 2
2012-09-24  No. 1224  Awful Show
2012-09-25  No. 1225  Garfield Plus Original Three Nicktoons
2012-09-26  No. 1226  Lioness Garfield
2012-09-27  No. 1227  Garfield Plus Proper Structure
2012-09-28  No. 1228  Garfield Plus Superlatively Updated Palaeontology Plus "Funny"
2012-09-29  No. 1229  Total Substitution Garfield
2012-09-30  No. 1230  Better Latin Garfield
2012-10-01  No. 1231  Mime Wasting Time!
2012-10-02  No. 1232  Canary Tale
2012-10-03  No. 1233  Duncan GoNuts
2012-10-04  No. 1234  Screen Capture
2012-10-05  No. 1235  Obvious Crossover (Wolverine)
2012-10-06  No. 1236  Garfield's Science Fiction Theatre
2012-10-07  No. 1237  SASE Garfield
2012-10-08  No. 1238  Ugly Fish
2012-10-09  No. 1239  Camptown Garfield
2012-10-10  No. 1240  Garfield Automatic Response Garfield
2012-10-11  No. 1241  The Picnic Panic
2012-10-12  No. 1242  One Little Letter
2012-10-13  No. 1243  Spot The Difference With Garfield 4
2012-10-14  No. 1244  Measure for Measure
2012-10-15  No. 1245  Reversed
2012-10-16  No. 1246  Jungle
2012-10-17  No. 1247  Black Eyed Garfield
2012-10-18  No. 1248  Garfield Times Garfield Times 2
2012-10-19  No. 1249  Elevenfield
2012-10-20  No. 1250  Garfield's Horror Theatre Plus Actual Horror
2012-10-21  No. 1251  Unusually Recoloured Garfield
2012-10-22  No. 1252  Stay In Character, Garfield
2012-10-23  No. 1253  We Got the Beat(s)
2012-10-24  No. 1254  U.S. Blues
2012-10-25  No. 1255  Garfield for Dogs
2012-10-26  No. 1256  Garfield Plus Crazy Frog 2
2012-10-27  No. 1257  Imaginary Jon: Catburger
2012-10-28  No. 1258  Return of Mind Screwfield
2012-10-29  No. 1259  Every Fish on Earth
2012-10-30  No. 1260  Obvious Crossover (Homer Simpson)
2012-10-31  No. 1261  Garfield Doesn't Care Any More
2012-11-01  No. 1262  Switching Places That Seem Ambiguous Unless Last Panel is Shown
2012-11-02  No. 1263  Garfield's Radio Theatre
2012-11-03  No. 1264  Primordial Ooze
2012-11-04  No. 1265  Spite Unseen
2012-11-05  No. 1266  How the House Got Rid of the Mouse
2012-11-06  No. 1267  Forbidden Cat
2012-11-07  No. 1268  Popsickle
2012-11-08  No. 1269  Square Root of Chocolate Pudding
2012-11-09  No. 1270  N+7 Garfield
2012-11-10  No. 1271  Goofless Garfield
2012-11-11  No. 1272  Jon's Chat Screen 2
2012-11-12  No. 1273  Contuinityfield
2012-11-13  No. 1274  Garfield Didn't Do It
2012-11-14  No. 1275  Square Root of Minus The Arbuckle Family in Reruns
2012-11-15  No. 1276  Clothes
2012-11-16  No. 1277  Booby Trapped
2012-11-17  No. 1278  Common Sentence Garfield
2012-11-18  No. 1279  Jon Speaks his Mind
2012-11-19  No. 1280  Inconsistent Background Garfield
2012-11-20  No. 1281  Donut Wars
2012-11-21  No. 1282  GaRFCeld
2012-11-22  No. 1283  Mr. Arbuckle's Cat
2012-11-23  No. 1284  Jon's Chat Screen 3
2012-11-24  No. 1285  Internet Phones
2012-11-25  No. 1286  947f13ld
2012-11-26  No. 1287  Omeglefield
2012-11-27  No. 1288  Latin Square of Minus Garfield
2012-11-28  No. 1289  MailBox
2012-11-29  No. 1290  UNCE UNCE UNCE UNCE
2012-11-30  No. 1291  Squeezedfield
2012-12-01  No. 1292  Seafood Can Be Hazardous To Your Health
2012-12-02  No. 1293  Garfstuck
2012-12-03  No. 1294  Com c w thout tt s om 's N m
2012-12-04  No. 1295  Randomiser 2
2012-12-05  No. 1296  Multiple Meowka Mix
2012-12-06  No. 1297  Garfield Flipped
2012-12-07  No. 1298  Squeezedfield - Vertical
2012-12-08  No. 1299  Accidental Garfield?
2012-12-09  No. 1300  Falling Garfield Fixed
2012-12-10  No. 1301  Over Andover MN
2012-12-11  No. 1302  Garfield Plus Quality Control
2012-12-12  No. 1303  One-Piecers
2012-12-13  No. 1304  Scared Jon
2012-12-14  No. 1305  Byrdfield
2012-12-15  No. 1306  Aresquay Ootray of Inusmay Arfieldgay
2012-12-16  No. 1307  Conscience
2012-12-17  No. 1308  Scat Talkin'
2012-12-18  No. 1309  Sychronised Garfield and U.S. Acres
2012-12-19  No. 1310  Inappropriately Timed Car Horn is Inappropriate
2012-12-20  No. 1311  Don't make me kill you
2012-12-21  No. 1312  Dumbfield Instead of Darkfield
2012-12-22  No. 1313  Dumbfield and Darkfield
2012-12-23  No. 1314  Garfield Minus Record Player
2012-12-24  No. 1315  Won't Get Fooled Acane
2012-12-25  No. 1316  Spot The Difference With Garfield 5
2012-12-26  No. 1317  Jon's Chat Screen 4
2012-12-27  No. 1318  Stay In Character, Garfield: The Redux
2012-12-28  No. 1319  Take That
2012-12-29  No. 1320  Is that good acting?
2012-12-30  No. 1321  Garfield Minus Garfield - Value Added: Salad
2012-12-31  No. 1322  The Last SRoMG Strip
2013-01-01  No. 1323  The Mailman's Dog
2013-01-02  No. 1324  Glue is for Saturday
2013-01-03  No. 1325  Birthdayfield
2013-01-04  No. 1326  Deltafield
2013-01-05  No. 1327  Love, Pastries, Action, and Pudding
2013-01-06  No. 1328  Garfield Minus Garfield Plus Good Reasons
2013-01-07  No. 1329  Poke-G
2013-01-08  No. 1330  Choose Your Own Garfield #2
2013-01-09  No. 1331  Favourite Person
2013-01-10  No. 1332  Bad Mood Guacamole Garfield
2013-01-11  No. 1333  Jon Entertains Himself
2013-01-12  No. 1334  Donutshave
2013-01-13  No. 1335  Jon's Chat Screen X
2013-01-14  No. 1336  Caesarfield
2013-01-15  No. 1337  Woo Fusion
2013-01-16  No. 1338  It doesn't matter what the ring tone is
2013-01-17  No. 1339  Bad Mood Clam Dip Garfield
2013-01-18  No. 1340  Kill the President
2013-01-19  No. 1341  Sunday Every Day #2
2013-01-20  No. 1342  Lampshadefield
2013-01-21  No. 1343  Foreshadowing
2013-01-22  No. 1344  Even Cleverbot doesn't like him...
2013-01-23  No. 1345  The Gar(field) Side
2013-01-24  No. 1346  Mailman's Revenge
2013-01-25  No. 1347  Bad Mood Wasabi Garfield
2013-01-26  No. 1348  Uncomfortable Truthsfield
2013-01-27  No. 1349  Garfield in Haiku Once Again
2013-01-28  No. 1350  Garfield Plus Updated Palaeontology Minus Dinosaurs
2013-01-29  No. 1351  Constant Turmoil
2013-01-30  No. 1352  Role-reversed Garfield
2013-01-31  No. 1353  Donut Wars, Continued
2013-02-01  No. 1354  Derivative of (Garfield minus Characters minus Background minus Props minus World minus Date)
2013-02-02  No. 1355  Can't Stop Thinking About It
2013-02-03  No. 1356  It Burns
2013-02-04  No. 1357  Garfieldseed
2013-02-05  No. 1358  No Sense of Scale
2013-02-06  No. 1359  Donut Wars: The Sueing Saga
2013-02-07  No. 1360  Leopard Skin
2013-02-08  No. 1361  Jon's "Chat" Screen
2013-02-09  No. 1362  Garfield Plus Square Root of Winnie the Pooh
2013-02-10  No. 1363  Freight Train Garfield
2013-02-11  No. 1364  Garfield Made Slightly Disturbing
2013-02-12  No. 1365  Even More Classified Garfield
2013-02-13  No. 1366  The Scream
2013-02-14  No. 1367  Garfield Minus Humour
2013-02-15  No. 1368  Change the Channel
2013-02-16  No. 1369  Take That, Scrappy!
2013-02-17  No. 1370  Dark Side of the Lasagne 3: The Continuing Reign of Terror
2013-02-18  No. 1371  The Most Horrific Theatre of All
2013-02-19  No. 1372  Gunpoint
2013-02-20  No. 1373  Terrible Quality Birthday Thing
2013-02-21  No. 1374  Dinner
2013-02-22  No. 1375  Predictions
2013-02-23  No. 1376  Lumpy Back
2013-02-24  No. 1377  Odiefield 2
2013-02-25  No. 1378  Scale Land
2013-02-26  No. 1379  Kooloo-Limpahfield
2013-02-27  No. 1380  Garfield of Dreams
2013-02-28  No. 1381  You Sunk My Battleship
2013-03-01  No. 1382  Garfield Beat Garfield
2013-03-02  No. 1383  Of Spiders and Woodstock
2013-03-03  No. 1384  Jon's Dinner Plate
2013-03-04  No. 1385  Fernfield
2013-03-05  No. 1386  The Steak is (not)? a Lie!
2013-03-06  No. 1387  Clip Artfield
2013-03-07  No. 1388  HEYYEYAAEYAAAEYAEYAA
2013-03-08  No. 1389  Present Tense
2013-03-09  No. 1390  Garfield, Prince of Denmark
2013-03-10  No. 1391  Garfield's Masterpiece Theatre
2013-03-11  No. 1392  Spot the Difference with Garfield 6
2013-03-12  No. 1393  Cat Among the Pidgins
2013-03-13  No. 1394  Unfini
2013-03-14  No. 1395  That Might Could May Possibly To an Extent Be What She Said
2013-03-15  No. 1396  Jon's Chat Screen Negativia
2013-03-16  No. 1397  Spot the Difference
2013-03-17  No. 1398  Steak Sauce
2013-03-18  No. 1399  Indestructible Phone
2013-03-19  No. 1400  Crying Over Spoiled Milk
2013-03-20  No. 1401  The Cat Who Walked Through...
2013-03-21  No. 1402  Changefield #7
2013-03-22  No. 1403  Penguin Eater
2013-03-23  No. 1404  Garfield Pulled From the Trash
2013-03-24  No. 1405  Fine Line of Rope
2013-03-25  No. 1406  Parthenon Model
2013-03-26  No. 1407  Mean
2013-03-27  No. 1408  Ordinaryfield
2013-03-28  No. 1409  Pick Your Mediocre Poison
2013-03-29  No. 1410  Jon's Chat Screen Negativia Cellphone Remix
2013-03-30  No. 1411  Wonderfield
2013-03-31  No. 1412  The Doughnut Wars Odyssey
2013-04-01  No. 1413  Catamari
2013-04-02  No. 1414  Time Bomb
2013-04-03  No. 1415  Garfield In Reality
2013-04-04  No. 1416  Left-Hand Traffic
2013-04-05  No. 1417  Bingo
2013-04-06  No. 1418  Garfield Minus Music
2013-04-07  No. 1419  Grafield & Maynard
2013-04-08  No. 1420  Garfield Plus Updated Palaeontology Minus Dinosaurs Plus Corrected Biogeography
2013-04-09  No. 1421  Two Often Used Square Root Of Minus Garfield Memes Combined To Make a Strip of Square Root of Minus Garfield
2013-04-10  No. 1422  Not Funny
2013-04-11  No. 1423  Blowing Out the Bomb
2013-04-12  No. 1424  Garfield's POV
2013-04-13  No. 1425  Garfield Minus Enthusiasm
2013-04-14  No. 1426  Donut Pop
2013-04-15  No. 1427  Garfield Around the Web WTF
2013-04-16  No. 1428  Nick-ah-low-dee-yun!
2013-04-17  No. 1429  Average Garfield 2012
2013-04-18  No. 1430  Zadie Smithfield
2013-04-19  No. 1431  Lovesick
2013-04-20  No. 1432  Covered Up
2013-04-21  No. 1433  Garfield 2.0
2013-04-22  No. 1434  I Love Lasagna
2013-04-23  No. 1435  Garfield plus Jon plus Liz plus Sherlock text messages
2013-04-24  No. 1436  Clever Use of Symbolism
2013-04-25  No. 1437  Garfield Turns Into A Dog
2013-04-26  No. 1438  Corrected Cheese Garfield
2013-04-27  No. 1439  Genre Awarenessfield
2013-04-28  No. 1440  I seek originality! But a meme will do
2013-04-29  No. 1441  Colour, Coming Through
2013-04-30  No. 1442  Donutception, Or How I Learned To Stop Worrying And Love The Donut (Wars)
2013-05-01  No. 1443  Square Root of Garfield Multipled by Calvin and Hobbes
2013-05-02  No. 1444  Fresh as a Daisy
2013-05-03  No. 1445  Backfield
2013-05-04  No. 1446  Garfield plus Backgrounds
2013-05-05  No. 1447  Cluster Bomb
2013-05-06  No. 1448  Cat Food
2013-05-07  No. 1449  Garfield in Red II
2013-05-08  No. 1450  Nail
2013-05-09  No. 1451  Viking Resemblance
2013-05-10  No. 1452  Names
2013-05-11  No. 1453  Reverse Change
2013-05-12  No. 1454  Gaston's Chat Room
2013-05-13  No. 1455  Frenchfield
2013-05-14  No. 1456  Walk This Way
2013-05-15  No. 1457  Garfield plus Calvin's Snowmen
2013-05-16  No. 1458  Minimalist Donut Wars
2013-05-17  No. 1459  Last Night's Date
2013-05-18  No. 1460  Garfield is Apathetic
2013-05-19  No. 1461  Garfield Made Slightly Disturbing 2
2013-05-20  No. 1462  Darkfield: Odie and the Murder
2013-05-21  No. 1463  Garfield Minus Theory of Mind
2013-05-22  No. 1464  Cooler
2013-05-23  No. 1465  Another Uncanny Ability of Writers
2013-05-24  No. 1466  April of No Sundays: 2006
2013-05-25  No. 1467  Hat?
2013-05-26  No. 1468  Pinky and the Garfield
2013-05-27  No. 1469  NESField 3
2013-05-28  No. 1470  Semanticfield
2013-05-29  No. 1471  Sbod the Dibberence wid Garbield
2013-05-30  No. 1472  Schrödinner
2013-05-31  No. 1473  The Webcomic That Lived on the Internet, Behind a Pop-Up, Next to the Scroll Bar, and to the Left of a Long Title
2013-06-01  No. 1474  NOT(Garfield)
2013-06-02  No. 1475  Happy Thoughts
2013-06-03  No. 1476  Simple Re-contextualization
2013-06-04  No. 1477  Jonfield
2013-06-05  No. 1478  Happy Blender
2013-06-06  No. 1479  Changefield #8
2013-06-07  No. 1480  Back to the Present
2013-06-08  No. 1481  Guitar-Playing Cat
2013-06-09  No. 1482  Munch Munch
2013-06-10  No. 1483  Burial
2013-06-11  No. 1484  GoComicsfield
2013-06-12  No. 1485  Angst
2013-06-13  No. 1486  Pierre Menard, Author of Garfield
2013-06-14  No. 1487  Blubber Lumps! They're chewy!
2013-06-15  No. 1488  Garfield Timus Garfield
2013-06-16  No. 1489  Interesting commercial
2013-06-17  No. 1490  Donut Wars in Soviet Russia
2013-06-18  No. 1491  Collagefield
2013-06-19  No. 1492  Sock Drawer
2013-06-20  No. 1493  Fair (Dinkum) Root of Minus Garfield
2013-06-21  No. 1494  Garfield in 2053
2013-06-22  No. 1495  Dark Re-contextualisation
2013-06-23  No. 1496  Garthenon (or The Epic of Garfield)
2013-06-24  No. 1497  Proved His Point
2013-06-25  No. 1498  I Am the Very Model of a Cartoon Individual
2013-06-26  No. 1499  Going with the Flow
2013-06-27  No. 1500  Unrealfield
2013-06-28  No. 1501  Blah
2013-06-29  No. 1502  Less Disturbing Recontextualisation
2013-06-30  No. 1503  Garfield Miserables Garfield
2013-07-01  No. 1504  More Sociable Garfield
2013-07-02  No. 1505  Polyphemus's Donut
2013-07-03  No. 1506  Garfield's Sophisticated Taste
2013-07-04  No. 1507  There Goes All the "Garfield Is Dead" Theories
2013-07-05  No. 1508  Garfield in 2053, Part 2
2013-07-06  No. 1509  Good One
2013-07-07  No. 1510  Per-Month Average Garfield 2012
2013-07-08  No. 1511  Garfield Minus Dinosaurs Plus Timey Wimey Ball
2013-07-09  No. 1512  Sophisticated Tastes
2013-07-10  No. 1513  Squarus Rootus
2013-07-11  No. 1514  Reunion
2013-07-12  No. 1515  Garfield Thinker Garfield
2013-07-13  No. 1516  Take this
2013-07-14  No. 1517  Emotional Breakdownfield
2013-07-15  No. 1518  Beautiful Inlawfield
2013-07-16  No. 1519  Spot The Difference With Garfield's... Toes?
2013-07-17  No. 1520  Garfield Plus an Actual Pepper
2013-07-18  No. 1521  Godotfield
2013-07-19  No. 1522  Entropy
2013-07-20  No. 1523  Catsup
2013-07-21  No. 1524  Skeleton in the Closet
2013-07-22  No. 1525  Into the Future
2013-07-23  No. 1526  Garfield in 2053, Part 3
2013-07-24  No. 1527 
2013-07-25  No. 1528  Tiberiumfield
2013-07-26  No. 1529  Alternianfield
2013-07-27  No. 1530  Silence Speaks Louder than Words
2013-07-28  No. 1531  Uvula
2013-07-29  No. 1532  Misanthropic Garfield
2013-07-30  No. 1533  Garfield's Memory
2013-07-31  No. 1534  Lyman?
2013-08-01  No. 1535  Colour-Averaged Garfield: 2053
2013-08-02  No. 1536  Got Milk?
2013-08-03  No. 1537  Garfield Made Slighty Disturbing 3
2013-08-04  No. 1538  Curiosity
2013-08-05  No. 1539  Early Christmas present
2013-08-06  No. 1540  Donut Symbolism
2013-08-07  No. 1541  Empire of Garfield
2013-08-08  No. 1542  The World Revolves Around Garfield
2013-08-09  No. 1543  Horsefield
2013-08-10  No. 1544  Complete Monster Jon
2013-08-11  No. 1545  Mook
2013-08-12  No. 1546  Fan Dumbfield
2013-08-13  No. 1547  Garfijldo
2013-08-14  No. 1548  Jon Tries to Cope
2013-08-15  No. 1549  Backfield Minus Back
2013-08-16  No. 1550  Figured It Out
2013-08-17  No. 1551  Garfield Minus Character Visuals
2013-08-18  No. 1552  Garfield Plus Corrected Biogeography Minus Palaeontology and Dinosaurs Plus Subtlety
2013-08-19  No. 1553  Timeless Cereal
2013-08-20  No. 1554  Somebody Stop Him
2013-08-21  No. 1555  Blue Monday
2013-08-22  No. 1556  Garfield's Haruhi Theatre
2013-08-23  No. 1557  A Week of Garfield
2013-08-24  No. 1558  Insanity
2013-08-25  No. 1559  Garfield Plus Oobi
2013-08-26  No. 1560  May of No Sundays 2013
2013-08-27  No. 1561  All Along the Watchtower
2013-08-28  No. 1562  License Number
2013-08-29  No. 1563  Rare Sentence Garfield #2
2013-08-30  No. 1564  Forced Meme/Lovely Fire
2013-08-31  No. 1565  Donut Wars: Donuttate
2013-09-01  No. 1566  Cut & Pastefield
2013-09-02  No. 1567  (Not so) Hidden Message
2013-09-03  No. 1568  Just as Planned
2013-09-04  No. 1569  Grafield Plus Dynamite
2013-09-05  No. 1570  Suspicions
2013-09-06  No. 1571  Gimpfield
2013-09-07  No. 1572  DED
2013-09-08  No. 1573  We've Got Donut Sign
2013-09-09  No. 1574  Memorable Record
2013-09-10  No. 1575  Photo-Shopped
2013-09-11  No. 1576  Rights & Wrongs
2013-09-12  No. 1577  Scary Jon
2013-09-13  No. 1578  Toilet Humour
2013-09-14  No. 1579  Garfield Minecraft Garfield
2013-09-15  No. 1580  Up Harass
2013-09-16  No. 1581  Garfield Meets Tardarsauce
2013-09-17  No. 1582  Plant Come On
2013-09-18  No. 1583  1978field
2013-09-19  No. 1584  Reverse Alphabetical Ordering
2013-09-20  No. 1585  Gaardvark
2013-09-21  No. 1586  Brewing Up With Jon Arbuckle
2013-09-22  No. 1587  That's why
2013-09-23  No. 1588  Lasagnas & Litterboxes
2013-09-24  No. 1589  Cat Memes
2013-09-25  No. 1590  Actual Happy Thoughts
2013-09-26  No. 1591  Donut Wars: Chowder Edition
2013-09-27  No. 1592  Jon's Shocking Reveal!
2013-09-28  No. 1593  All Your Garfield Are Belong To Us
2013-09-29  No. 1594  Unpopular Opinion Garfield
2013-09-30  No. 1595  Violence-Free Garfield
2013-10-01  No. 1596  Exchange Program
2013-10-02  No. 1597  Self-Deprecating Humour?
2013-10-03  No. 1598  Garfield Dies (again)
2013-10-04  No. 1599  Trust
2013-10-05  No. 1600  Cat Years
2013-10-06  No. 1601  Mariofield
2013-10-07  No. 1602  Dialogue Swap: English vs. Spanish
2013-10-08  No. 1603  Garfield Minus an S and a T
2013-10-09  No. 1604  Bees!
2013-10-10  No. 1605  Garfield Linus Garfield- The Prequel
2013-10-11  No. 1606  Garfield Linus Garfield: The Next Generation
2013-10-12  No. 1607  Life with Linus
2013-10-13  No. 1608  Impressions
2013-10-14  No. 1609  Doctor WhoField
2013-10-15  No. 1610  Garfield Who
2013-10-16  No. 1611  GarfIED
2013-10-17  No. 1612  More Sophisticated Garfield
2013-10-18  No. 1613  Catch the Durian
2013-10-19  No. 1614  Transactions of the Garfield Paleontological Society, Volume II
2013-10-20  No. 1615  Unsolved Mysteries part 2.
2013-10-21  No. 1616  Just to Clear Things Up
2013-10-22  No. 1617  One Panel Garfield
2013-10-23  No. 1618  Garfield Can't Stop
2013-10-24  No. 1619  Shelter Stories
2013-10-25  No. 1620  Gayfield
2013-10-26  No. 1621  Sekifield
2013-10-27  No. 1622  Bauzafield
2013-10-28  No. 1623  Donut Chivalry
2013-10-29  No. 1624  Died in the Donut War
2013-10-30  No. 1625  Donut Wars Made Even More Disturbing
2013-10-31  No. 1626  Garfield Meets The Thin Man
2013-11-01  No. 1627  Garfield in 2053, Part 4
2013-11-02  No. 1628  Garfield plus Health and Safety
2013-11-03  No. 1629  GarfieldSBAHJ
2013-11-04  No. 1630  Garf Side of the Horse
2013-11-05  No. 1631  Sex & drums & rock 'n' rollfield
2013-11-06  No. 1632  And I Must Scream
2013-11-07  No. 1633  De-Wrench
2013-11-08  No. 1634  Just Look At That Gorgeous Garfield
2013-11-09  No. 1635  Skelefield
2013-11-10  No. 1636  Super Meat Field
2013-11-11  No. 1637  Garfield Off-Script
2013-11-12  No. 1638  One Warped Wish
2013-11-13  No. 1639  Nothing
2013-11-14  No. 1640  The Garfield Channel
2013-11-15  No. 1641  Shakesfield
2013-11-16  No. 1642  Choice Words
2013-11-17  No. 1643  Garfield: 2053-11-28
2013-11-18  No. 1644  Therapy
2013-11-19  No. 1645  Reason #1 This Day Can Get Better
2013-11-20  No. 1646  Fifth Anniversary
2013-11-21  No. 1647  Reality
2013-11-22  No. 1648  Terran Empire
2013-11-23  No. 1649  Mega Garfield's Planet
2013-11-24  No. 1650  Cartoon Network
2013-11-25  No. 1651  Jon's Birthday
2013-11-26  No. 1652  Jon Ate Garfield
2013-11-27  No. 1653  Killer Smile
2013-11-28  No. 1654  Straw
2013-11-29  No. 1655  Garfield Groundhog Day Garfield
2013-11-30  No. 1656  Really Misanthropic Garfield
2013-12-01  No. 1657  Donut Wars: Toxicity
2013-12-02  No. 1658  Pinkerfield
2013-12-03  No. 1659  Gladosfield
2013-12-04  No. 1660  3-Bit RGBfield
2013-12-05  No. 1661  Skelefield 2
2013-12-06  No. 1662  Real Life Garfield
2013-12-07  No. 1663  World-Class Pancake Flipper
2013-12-08  No. 1664  Hello Garfield
2013-12-09  No. 1665  Omnomfield
2013-12-10  No. 1666  Grafield Minus Grafield
2013-12-11  No. 1667  Shiny Teeth
2013-12-12  No. 1668  Flanfield
2013-12-13  No. 1669  Might as well talk to a wall
2013-12-14  No. 1670  Obvious Crossover (Mr. Spock)
2013-12-15  No. 1671  Garfield Plus Doonesbury Minus Newspapers
2013-12-16  No. 1672  Square Root of Billy Brick
2013-12-17  No. 1673  Inverted Backfield
2013-12-18  No. 1674  Garfield Minus Subtlety
2013-12-19  No. 1675  Cubefield
2013-12-20  No. 1676  Dark Nightmarefield
2013-12-21  No. 1677  What's Wrong With the World
2013-12-22  No. 1678  Jon's Chat Screen Negativia Reversed Peanuts Garfield Remix Remix
2013-12-23  No. 1679  Verin's Chat Screen
2013-12-24  No. 1680  Cartoon Ducks
2013-12-25  No. 1681  Nedroidfield
2013-12-26  No. 1682  Through the Fourth Wall
2013-12-27  No. 1683  Grimdull Garfield
2013-12-28  No. 1684  Good Dog
2013-12-29  No. 1685  Garfield Plus MS Paint Colours
2013-12-30  No. 1686  Ted Turner's Garfield
2013-12-31  No. 1687  2012-12-21
2014-01-01  No. 1688  Uncle Forrest
2014-01-02  No. 1689  I Want Everyone In It! (aka: Continuity Nod)
2014-01-03  No. 1690  Garfield's History of the Triad
2014-01-04  No. 1691  Garfield sings The Beatles #1
2014-01-05  No. 1692  Garfield Saves Dinner
2014-01-06  No. 1693  Web Affair
2014-01-07  No. 1694  Cornfield
2014-01-08  No. 1695  Mildly Obscure Reference Time!
2014-01-09  No. 1696  Double Shred
2014-01-10  No. 1697  What the ****?
2014-01-11  No. 1698  Cat Cookie Report
2014-01-12  No. 1699  Garfood
2014-01-13  No. 1700  Spotting the Difference
2014-01-14  No. 1701  Kiss Me Fat Cat
2014-01-15  No. 1702  Humorous
2014-01-16  No. 1703  Galloping Alien
2014-01-17  No. 1704  Shifting Mid-Point 2
2014-01-18  No. 1705  Invisible Cat
2014-01-19  No. 1706  Hug Day
2014-01-20  No. 1707  Evolution
2014-01-21  No. 1708  Parallel Universe
2014-01-22  No. 1709  Garfield Made Slightly Disturbing: Garfield's Shocking Discovery
2014-01-23  No. 1710  Ignorant Garfield
2014-01-24  No. 1711  The Product of Garfield and Calvin and Hobbes over Happy Days
2014-01-25  No. 1712  Tie Stain
2014-01-26  No. 1713  Bit Glitchfield
2014-01-27  No. 1714  Nonchalant
2014-01-28  No. 1715  That Ham in the Fridge
2014-01-29  No. 1716  Presidential Campaign
2014-01-30  No. 1717  Disgustfield
2014-01-31  No. 1718  Garfield Past and Future
2014-02-01  No. 1719  You know, Jon...
2014-02-02  No. 1720  Popcorn Advice
2014-02-03  No. 1721  Obvious Crossover (Dukey Test)
2014-02-04  No. 1722  Jon's Worries Come To Pass
2014-02-05  No. 1723  Perecfield
2014-02-06  No. 1724  Jon Tries to Kill Garfield
2014-02-07  No. 1725  Alive or Dead
2014-02-08  No. 1726  Sign-Up Now for Only $19.99 a Month!
2014-02-09  No. 1727  Tom Waitsfield
2014-02-10  No. 1728  Garfield and the Oobleck
2014-02-11  No. 1729  Garfield Shrink & Re-enlarge, Literally
2014-02-12  No. 1730  Fat Guy's Small Eyes
2014-02-13  No. 1731  Die with a T
2014-02-14  No. 1732  Bang-ana
2014-02-15  No. 1733  Family Hat
2014-02-16  No. 1734  Garfield for the Gold
2014-02-17  No. 1735  Playing Possum
2014-02-18  No. 1736  Garfield Minus "The"
2014-02-19  No. 1737  Garfield plus Lyman Hall
2014-02-20  No. 1738  Saturday Night of the Living Blender
2014-02-21  No. 1739  What Time is it?
2014-02-22  No. 1740  Garfield's 75th Birthday
2014-02-23  No. 1741  Another Fine Mess
2014-02-24  No. 1742  Odie Minus Everyone Else
2014-02-25  No. 1743  Acid Balloon
2014-02-26  No. 1744  The Melancholy/Disappearance of Garfield's Haruhi Theatre
2014-02-27  No. 1745  Jon Arblanka
2014-02-28  No. 1746  Garfield Minus Christmas Tree Plus Bored
2014-03-01  No. 1747  Garfield Plus Weedles
2014-03-02  No. 1748  The Wolf Dog
2014-03-03  No. 1749  Garfield Hates Christmas
2014-03-04  No. 1750  French
2014-03-05  No. 1751  Finch
2014-03-06  No. 1752  Clive Again
2014-03-07  No. 1753  Past in Flux
2014-03-08  No. 1754  Less Morbid Than It Looks
2014-03-09  No. 1755  Going to the Beach
2014-03-10  No. 1756  The X-Fields
2014-03-11  No. 1757  Garfield's Odyssey
2014-03-12  No. 1758  Belching Contest
2014-03-13  No. 1759  Fly Fusion
2014-03-14  No. 1760  Gotta Dance
2014-03-15  No. 1761  Static
2014-03-16  No. 1762  Mirror Barking
2014-03-17  No. 1763  Garfield Irish Garfield (St. Patrick’s Day Special)
2014-03-18  No. 1764  Baby, It's Cold Inside
2014-03-19  No. 1765  Skinfield
2014-03-20  No. 1766  la garfild.
2014-03-21  No. 1767  Garfield's Color Theater
2014-03-22  No. 1768  Square Root Of Minus Grandpa
2014-03-23  No. 1769  Slowfield
2014-03-24  No. 1770  Empirical
2014-03-25  No. 1771  Garfield Hat Pirates (Or: 'One Garfield')
2014-03-26  No. 1772  Garfield Surrenders to the Mice
2014-03-27  No. 1773  Is Everything Better With Monkeys?
2014-03-28  No. 1774  Garfield versus Zombies
2014-03-29  No. 1775  Garfield Plus Mutilation
2014-03-30  No. 1776  A Tiger in the House
2014-03-31  No. 1777  Calvin Makes a SRoMG Strip
2014-04-01  No. 1778  Grafield Minus Garfield
2014-04-02  No. 1779  Letter to Santa
2014-04-03  No. 1780  Flandrefield
2014-04-04  No. 1781  Standing Tall
2014-04-05  No. 1782  Garfield Plus The Dungeons & Dragons Monster Manual
2014-04-06  No. 1783  Garfield's Past Made Disturbing
2014-04-07  No. 1784  Complex Little Creatures
2014-04-08  No. 1785  Fan FictionField
2014-04-09  No. 1786  Garfield Plus Cartoon Bomb (And Minus Four and a Half Panels)
2014-04-10  No. 1787  Fake-Out Steak-Out Break-Out
2014-04-11  No. 1788  Growing the Beard
2014-04-12  No. 1789  Flubber
2014-04-13  No. 1790  Square Root of Negative Over the Hedge?
2014-04-14  No. 1791  Miscalculation
2014-04-15  No. 1792  Insert Your Own Take That Here
2014-04-16  No. 1793  ... Backfield
2014-04-17  No. 1794  Kitty Treats
2014-04-18  No. 1795  Inverse Opinion
2014-04-19  No. 1796  Medleyfield
2014-04-20  No. 1797  Down, Down
2014-04-21  No. 1798  Do Wah Diddy Diddy
2014-04-22  No. 1799  Infinite Scrolling
2014-04-23  No. 1800  Waluigi Time
2014-04-24  No. 1801  Good Housekeeping
2014-04-25  No. 1802  A More Subtle Crossover
2014-04-26  No. 1803  Garfield Plus Clive
2014-04-27  No. 1804  Comic Of A Thousand Punchlines
2014-04-28  No. 1805  Garfield plus Labour Retention
2014-04-29  No. 1806  Shy Guy Field
2014-04-30  No. 1807  Thrill Seekers
2014-05-01  No. 1808  Mutagenfield
2014-05-02  No. 1809  Game Developer Garfield
2014-05-03  No. 1810  Reedfield
2014-05-04  No. 1811  Tempting Fate
2014-05-05  No. 1812  Jon plus #epicfail
2014-05-06  No. 1813  Subversion
2014-05-07  No. 1814  Garfield and the Cursed Mirror
2014-05-08  No. 1815  Sock Puppet Minus Garfield 2
2014-05-09  No. 1816  Tuna the Garfield
2014-05-10  No. 1817  1988 to 1979
2014-05-11  No. 1818  Jon's Evolution in Reverse (including Garfield)
2014-05-12  No. 1819  Meta Mid-Point
2014-05-13  No. 1820  xkcd Randomiser
2014-05-14  No. 1821  Shifting Mid-Point 3
2014-05-15  No. 1822  The Return of the King
2014-05-16  No. 1823  Their Name Starts With C-A-T And Contains 'Leopard', So It's Only Natural, Really
2014-05-17  No. 1824  Mailman's Wallet
2014-05-18  No. 1825  A Strip Of Square Root of Minus Garfield That Happened
2014-05-19  No. 1826  Forgot About Those
2014-05-20  No. 1827  Calvin And Garfield
2014-05-21  No. 1828  Even Higher
2014-05-22  No. 1829  Sophisticated
2014-05-23  No. 1830  Squigglefield
2014-05-24  No. 1831  These Doughnuts Are Great!
2014-05-25  No. 1832  Depressed
2014-05-26  No. 1833  Novocaine
2014-05-27  No. 1834  Lost Two Men
2014-05-28  No. 1835  Garfield Is Unfunny
2014-05-29  No. 1836  Club Penguinfield
2014-05-30  No. 1837  Recapfield
2014-05-31  No. 1838  Garfield in LA
2014-06-01  No. 1839  Garfield Plus Grammar Nazi
2014-06-02  No. 1840  Garfield Minus Jon's Mother
2014-06-03  No. 1841  Fair Exchange
2014-06-04  No. 1842  Denied
2014-06-05  No. 1843  30 Garf
2014-06-06  No. 1844  Grammy-Winning Garfield
2014-06-07  No. 1845  Fat and Proud
2014-06-08  No. 1846  Paws Inc.'s Own Square Root of Minus Garfield
2014-06-09  No. 1847  Bioluminescencefield
2014-06-10  No. 1848  Garfield Plus Mr. Potato Head
2014-06-11  No. 1849  Sour Milk-Chan
2014-06-12  No. 1850  Garfield Minus Nermal Plus Nergal
2014-06-13  No. 1851  Gym Class Garfield
2014-06-14  No. 1852  Spot the Difference with Garfield: Driver's License Edition
2014-06-15  No. 1853  Metajoke Garfield 2
2014-06-16  No. 1854  Make No Bones About It
2014-06-17  No. 1855  Failed Selfish Thinking
2014-06-18  No. 1856  Garfield and Jon Plus 23 Years
2014-06-19  No. 1857  Spot the Difference with Garfield & Liz
2014-06-20  No. 1858  Wrench Wench
2014-06-21  No. 1859  Vegan Garfield
2014-06-22  No. 1860  I know that was then but it could be againfield
2014-06-23  No. 1861  Vertical Sundays
2014-06-24  No. 1862  Past In Flux Redux
2014-06-25  No. 1863  Engineer has Tools
2014-06-26  No. 1864  Volatile Odie Minus Everyone Else
2014-06-27  No. 1865  Gar*PYOO*Garfield
2014-06-28  No. 1866  Gone Fishin'
2014-06-29  No. 1867  Silent and Physical
2014-06-30  No. 1868  Oboy!
2014-07-01  No. 1869  Slow in more ways than one
2014-07-02  No. 1870  Particle Man
2014-07-03  No. 1871  Jon's Perception
2014-07-04  No. 1872  Garfield Plus Brewster Rockit
2014-07-05  No. 1873  Changefield #9
2014-07-06  No. 1874  Dark Side of the Lasagne: Aftermath
2014-07-07  No. 1875  Blender Meme Minus Blender and Internal Monologue
2014-07-08  No. 1876  Sockets
2014-07-09  No. 1877  Garfield Minus 1981 Plus 1992
2014-07-10  No. 1878  Tanukifield
2014-07-11  No. 1879  Awkward Pause
2014-07-12  No. 1880  Killer Odie
2014-07-13  No. 1881  Obvious Advertising
2014-07-14  No. 1882  Jon Minus Half of His Teeth
2014-07-15  No. 1883  Saturday Night Surprise
2014-07-16  No. 1884  Hilarious in Hindsight
2014-07-17  No. 1885  Cold Nose
2014-07-18  No. 1886  Donut Wars... and Zoidberg
2014-07-19  No. 1887  Irregularfield 2
2014-07-20  No. 1888  Thin and Proud
2014-07-21  No. 1889  Garfield Manny’s (Picture) Garfield
2014-07-22  No. 1890  One-Wayfield
2014-07-23  No. 1891  Subtly Less Subtle Garfield
2014-07-24  No. 1892  Whistle-blower
2014-07-25  No. 1893  Moussacre
2014-07-26  No. 1894  Garfevolution
2014-07-27  No. 1895  Surprise Surprise
2014-07-28  No. 1896  Jim Davis as Jon (Happy Birthday, Jim Davis)
2014-07-29  No. 1897  JonShocked Infinite
2014-07-30  No. 1898  Super Odie 64
2014-07-31  No. 1899  Rodents of Unusual Size
2014-08-01  No. 1900  The Madness of the Orange Cat
2014-08-02  No. 1901  Jon Skywalker vs Darth Garfield
2014-08-03  No. 1902  Garfield comic by Skye
2014-08-04  No. 1903  Teasing Reflection
2014-08-05  No. 1904  Jon Plus Sock Puppet Account
2014-08-06  No. 1905  Steamed Beats
2014-08-07  No. 1906  Racine carrée de Garfield moins: par deux
2014-08-08  No. 1907  Donut eat that!
2014-08-09  No. 1908  One Panel Garfield 3
2014-08-10  No. 1909  Garfield's Certainly Changed
2014-08-11  No. 1910  Never Finish What They Start
2014-08-12  No. 1911  Huge Ugly Heads
2014-08-13  No. 1912  Sudden Bellybutton
2014-08-14  No. 1913  Garfield Plus Cleaning Supplies
2014-08-15  No. 1914  Ron Swansonfield
2014-08-16  No. 1915  Lightning
2014-08-17  No. 1916  Spacious Garfield II
2014-08-18  No. 1917  Garfield in 2053, Part 7
2014-08-19  No. 1918  Invisible Ball
2014-08-20  No. 1919  Cookiefield
2014-08-21  No. 1920  Winter Wrap Up
2014-08-22  No. 1921  Garfield Plus A Single Speech Balloon
2014-08-23  No. 1922  House Cleaner part 3
2014-08-24  No. 1923  The Automatic Colouriser Takes Over (aka Garfield minus Jim Davis)
2014-08-25  No. 1924  The Dark World of the Dog
2014-08-26  No. 1925  Pasta Freak
2014-08-27  No. 1926  Decaffeinated
2014-08-28  No. 1927  All in a Name
2014-08-29  No. 1928  And so it begins...
2014-08-30  No. 1929  The Pudding Pop Horror
2014-08-31  No. 1930  Double the Chins
2014-09-01  No. 1931  Garfield Minus Enthusiasm for Garfield
2014-09-02  No. 1932  Garfield in Spanish
2014-09-03  No. 1933  Lucky Day
2014-09-04  No. 1934  Garfield Linus Garfield, Catholic Edition
2014-09-05  No. 1935  Garfield's Hungry
2014-09-06  No. 1936  SRoMG Compilation
2014-09-07  No. 1937  Kitty Corliss
2014-09-08  No. 1938  Inani-mates
2014-09-09  No. 1939  Followup
2014-09-10  No. 1940  Garfield Plus an Even Spicier Pepper
2014-09-11  No. 1941  Click
2014-09-12  No. 1942  This Is Garfield Calling Orson
2014-09-13  No. 1943  Fatter and Prouder
2014-09-14  No. 1944  Trees are Constantly Changing
2014-09-15  No. 1945  Hug?
2014-09-16  No. 1946  Garfield Mynocks Garfield
2014-09-17  No. 1947  Obliquefield
2014-09-18  No. 1948  Panelfield
2014-09-19  No. 1949  CENSORED
2014-09-20  No. 1950  Jon Is Not Totally Rad
2014-09-21  No. 1951  Desperation
2014-09-22  No. 1952  Reflect Upon the Past
2014-09-23  No. 1953  Reincarnated Garfield
2014-09-24  No. 1954  Potted Humour
2014-09-25  No. 1955  Garfield: The Last Bird-sledder
2014-09-26  No. 1956  The Dangers of Deep Sleep
2014-09-27  No. 1957  Garfield Minus Garfield, but More Honest
2014-09-28  No. 1958  Shifting Mid-Point 4
2014-09-29  No. 1959  The Wise Man Of The Mountain
2014-09-30  No. 1960  Colour-averaged average strips
2014-10-01  No. 1961  Duckfield
2014-10-02  No. 1962  What If Garfield Can Talk
2014-10-03  No. 1963  Heel-Face Garfield
2014-10-04  No. 1964  Flimsy Table
2014-10-05  No. 1965  Nothing
2014-10-06  No. 1966  In Character Garfield
2014-10-07  No. 1967  Negative Jon's Donut
2014-10-08  No. 1968  Garfield's Not Moving!!
2014-10-09  No. 1969  A Jon of Another Colour
2014-10-10  No. 1970  Ready Set Roll
2014-10-11  No. 1971  You Know WHO ELSE Is Slow!?
2014-10-12  No. 1972  EEE-EEE
2014-10-13  No. 1973  Garfield on Twitter
2014-10-14  No. 1974  Advantages to Growing Older... with an Idea
2014-10-15  No. 1975  A Brief Zoology Lesson
2014-10-16  No. 1976  Rice Cakes, or: How Garfield Somehow Has Simultaneously More And Less Imagination Than Jon
2014-10-17  No. 1977  New World Empire
2014-10-18  No. 1978  0th Birthday Special
2014-10-19  No. 1979  1st Birthday Special: Rocket Garfield
2014-10-20  No. 1980  2nd Birthday Special: Print, Cut Out, and Solve
2014-10-21  No. 1981  3rd Birthday Special: Metal Garfield Solid
2014-10-22  No. 1982  4th Birthday Special: Fire Safety Hazard
2014-10-23  No. 1983  5th Birthday Special: Early Surprise
2014-10-24  No. 1984  6th Birthday Special: Cooler Than a Rubber Chicken
2014-10-25  No. 1985  7th Birthday Special: Vanishing Surprise
2014-10-26  No. 1986  8th Birthday Special: Double Birthday Cake Special
2014-10-27  No. 1987  9th Birthday Special: Word Weirding
2014-10-28  No. 1988  10th Birthday Special: The Orange (Photo) Album
2014-10-29  No. 1989  11th Birthday Special: High Concept
2014-10-30  No. 1990  12th Birthday Special: Fridgefield
2014-10-31  No. 1991  13th Birthday Special: Inhale
2014-11-01  No. 1992  14th Birthday Special: Black Moon
2014-11-02  No. 1993  15th Birthday Special: Fifteen Candles
2014-11-03  No. 1994  16th Birthday Special: Surprise Package
2014-11-04  No. 1995  17th Birthday Special: Unhappy 17thfield
2014-11-05  No. 1996  18th Birthday Special: Garfield Minus Cake Plus Bong
2014-11-06  No. 1997  19th Birthday Special: Birthday Inferno
2014-11-07  No. 1998  20th Birthday Special: Unexpected Celebrations
2014-11-08  No. 1999  21st Birthday Special: Up to Twenty-One
2014-11-09  No. 2000  22nd Birthday Special: Deathday Garfield
2014-11-10  No. 2001  23rd Birthday Special: Garfield Potter
2014-11-11  No. 2002  24th Birthday Special: Mouse Surprise
2014-11-12  No. 2003  25th Birthday Special: Less Humour, More Story!: 2003 Edition
2014-11-13  No. 2004  26th Birthday Special: Another Birthday
2014-11-14  No. 2005  27th Birthday Special: Supercat
2014-11-15  No. 2006  28th Birthday Special: Forever Young and Virile
2014-11-16  No. 2007  29th Birthday Special: World's Cutest Present
2014-11-17  No. 2008  30th Birthday Special: Garfield Plus Slightly Better Pacing
2014-11-18  No. 2009  31st Birthday Special: Garfield Minus Liz
2014-11-19  No. 2010  32nd Birthday Special: Send in the Clones
2014-11-20  No. 2011  33rd Birthday Special: Birthday Cake
2014-11-21  No. 2012  34th Birthday Special: Garfield Plus Obvious Fourth Panel
2014-11-22  No. 2013  35th Birthday Special: Salad Sub
2014-11-23  No. 2014  36th Birthday Special: Too Far Back
2014-11-24  No. 2015  37th Birthday Special: 404 Error
2014-11-25  No. 2016  Detach
2014-11-26  No. 2017  Mildly Obscure Obvious Crossover (Caspar Milquetoast)
2014-11-27  No. 2018  Too Much Carbon
2014-11-28  No. 2019  Who Waxed the Fench Wrench?
2014-11-29  No. 2020  Fishing trip
2014-11-30  No. 2021  Hat-Head
2014-12-01  No. 2022  Obvious Pun (Grind)
2014-12-02  No. 2023  Garfield lost in thought
2014-12-03  No. 2024  Garfachu
2014-12-04  No. 2025  Jon & Calvin
2014-12-05  No. 2026  Binky Cereal
2014-12-06  No. 2027  Garfield Plus Literary Pretensions
2014-12-07  No. 2028  Garfield Minus Everything Beyond the First Line of Text
2014-12-08  No. 2029  Spot the Difference with Garfield and Orson
2014-12-09  No. 2030  Garfield Plus Fan Rage
2014-12-10  No. 2031  Cthulhu Cereal
2014-12-11  No. 2032  Pac-field
2014-12-12  No. 2033  Feline Nature
2014-12-13  No. 2034  Zappin' T-shirt
2014-12-14  No. 2035  Have You Ever?
2014-12-15  No. 2036  Montage Theory
2014-12-16  No. 2037  Fish Wars
2014-12-17  No. 2038  Garfield Plus Self-Commentary
2014-12-18  No. 2039  Words in Garfield Characters
2014-12-19  No. 2040  Obvious Crossover (Pac-Man)
2014-12-20  No. 2041  Magic Garfield
2014-12-21  No. 2042  Foot
2014-12-22  No. 2043  The Madness of the Orange Cat minus xkcd
2014-12-23  No. 2044  One Panel Garfield 4
2014-12-24  No. 2045  Quote Mine
2014-12-25  No. 2046  Garfield: Greg Land Edition
2014-12-26  No. 2047  Mad Photobomber
2014-12-27  No. 2048  Recycled Script Garfield
2014-12-28  No. 2049  Coffee Monster
2014-12-29  No. 2050  Cat Murder
2014-12-30  No. 2051  Irregularfield 3
2014-12-31  No. 2052  Dog Vision
2015-01-01  No. 2053  The Coffee Incident
2015-01-02  No. 2054  Web
2015-01-03  No. 2055  Snartfield
2015-01-04  No. 2056  What's inside the Fridge?
2015-01-05  No. 2057  Jetpack
2015-01-06  No. 2058  Extremely Misanthropic Garfield
2015-01-07  No. 2059  The Other Hawaiian Flu
2015-01-08  No. 2060  Overused Doooggg!
2015-01-09  No. 2061  Garfield Margin Garfield
2015-01-10  No. 2062  Garfield Minus Peppers
2015-01-11  No. 2063  Absent-Minded
2015-01-12  No. 2064  Nobody Likes Jon!
2015-01-13  No. 2065  The Bitmapisation of Garfield
2015-01-14  No. 2066  Lyman in the closet
2015-01-15  No. 2067  Choose Your Own Garfield Book 3: The Anti-Humour Equation!
2015-01-16  No. 2068  Banach-Tarskifield
2015-01-17  No. 2069  Pokeyfield
2015-01-18  No. 2070  Garfield in 2110
2015-01-19  No. 2071  Meta-Mashupability
2015-01-20  No. 2072  Garfield Plus Exegesis
2015-01-21  No. 2073  Hint Surprise
2015-01-22  No. 2074  Catonball: Round Two
2015-01-23  No. 2075  Smelly Cheese
2015-01-24  No. 2076  They Stopped Making Moustaches
2015-01-25  No. 2077  Garfield & Jon Photo Album
2015-01-26  No. 2078  Je suis Garfield
2015-01-27  No. 2079  If I Could Do It All Over Again, I'd Do It All Over You
2015-01-28  No. 2080  The Woman Who Speaks Only In MadLibs
2015-01-29  No. 2081  Panel Adjustment
2015-01-30  No. 2082  Slightly Saner Garfield
2015-01-31  No. 2083  Super Garfield Land 2
2015-02-01  No. 2084  Blizzard
2015-02-02  No. 2085  Garfdub
2015-02-03  No. 2086  Fishfield
2015-02-04  No. 2087  Pudding Pops Gag Minus Base Jokes Plus Dedication
2015-02-05  No. 2088  Zalgo Garfield 3
2015-02-06  No. 2089  How to Answer "What are you doing?" Without Knowing What You're Doing
2015-02-07  No. 2090  Hitchhiker's Guide to the Garfield
2015-02-08  No. 2091  Nothing-er
2015-02-09  No. 2092  Unlikely Statement
2015-02-10  No. 2093  Vitruvian Tongue
2015-02-11  No. 2094  Disaster Days
2015-02-12  No. 2095  GARFAX
2015-02-13  No. 2096  New Year's Repetition
2015-02-14  No. 2097  Jon Gone
2015-02-15  No. 2098  Mixed Reception
2015-02-16  No. 2099  Nermalevich The World's Cutest Kitten
2015-02-17  No. 2100  Garfthur and N.W.
2015-02-18  No. 2101  Bad Donut
2015-02-19  No. 2102  Mother Goose and Grimm plus Garfield
2015-02-20  No. 2103  Sweeney Garfield (aka Variations on a Haircut #3)
2015-02-21  No. 2104  Has This Ever Happened To You?
2015-02-22  No. 2105  Voice Actors Garfield
2015-02-23  No. 2106  Compound Recontextualization (AKA: Followup 2)
2015-02-24  No. 2107  Real Negative Jon's Donut
2015-02-25  No. 2108  Garfield Minus Ledge
2015-02-26  No. 2109  Griddlefield
2015-02-27  No. 2110  Basement
2015-02-28  No. 2111  Armchair Warrior
2015-03-01  No. 2112  The Art of the Dress
2015-03-02  No. 2113  Derpfield
2015-03-03  No. 2114  Jon the Unintentional Sacrifice
2015-03-04  No. 2115  How to tell different classes of arthropods apart
2015-03-05  No. 2116  Variations on a Haircut #4
2015-03-06  No. 2117  Self-Deprecation
2015-03-07  No. 2118  Zalgo Garfield 4
2015-03-08  No. 2119  Garfield Would Like To Solve The Puzzle Now
2015-03-09  No. 2120  Incremental Nothing
2015-03-10  No. 2121  Garfield on Twitter Revised
2015-03-11  No. 2122  Garfield Plus Actual Name of Fear
2015-03-12  No. 2123  I Smell a Lawsuit
2015-03-13  No. 2124  Garfield's First Show Cat
2015-03-14  No. 2125  Keeping Up
2015-03-15  No. 2126  Stuntmen have Feelings Too
2015-03-16  No. 2127  Dug Too Deep
2015-03-17  No. 2128  Gone Poundin'
2015-03-18  No. 2129  Without Me
2015-03-19  No. 2130  Grinch
2015-03-20  No. 2131  The Garfield Factory
2015-03-21  No. 2132  Swapped Dialogue Firsts
2015-03-22  No. 2133  Lightning Strike
2015-03-23  No. 2134  Garfield Plus Or Minus Halftone
2015-03-24  No. 2135  No, Garfield
2015-03-25  No. 2136  Shakespeare's (Way With) Words
2015-03-26  No. 2137  Garfield becomes Jon's Kid
2015-03-27  No. 2138  Modern Garfield
2015-03-28  No. 2139  Expired
2015-03-29  No. 2140  Zalgo Garfield 5
2015-03-30  No. 2141  Up to Beyond Eleven
2015-03-31  No. 2142  Garfield Minus One Dollar, or, "Jon Pays The Correct Amount" Edition
2015-04-01  No. 2143  Garfield Discovers "Loud Commercial"
2015-04-02  No. 2144  My Pulse Will Be Quickenin'
2015-04-03  No. 2145  Morris: His 9 Lives
2015-04-04  No. 2146  Trilingual Garfield
2015-04-05  No. 2147  It's Fun
2015-04-06  No. 2148  Brickfield 3: Memory Loss
2015-04-07  No. 2149  Planet of Garfield
2015-04-08  No. 2150  Descartesfield
2015-04-09  No. 2151  Fiberoptics
2015-04-10  No. 2152  Richard Shermanfield
2015-04-11  No. 2153  Carry on Wayward Cat
2015-04-12  No. 2154  The Real #1971
2015-04-13  No. 2155  Garfield Minus Gluttony
2015-04-14  No. 2156  Garfield ad Dino
2015-04-15  No. 2157  Set to Comic Strip
2015-04-16  No. 2158  Reversed Decayfield
2015-04-17  No. 2159  A Star's War
2015-04-18  No. 2160  Warning! Challenger Approaching!
2015-04-19  No. 2161  Second Longest
2015-04-20  No. 2162  Garfield's Science Fiction Theatre
2015-04-21  No. 2163  Adventurous Garfield
2015-04-22  No. 2164  Garfield Sheds
2015-04-23  No. 2165  Lord Helix
2015-04-24  No. 2166  Smarfield
2015-04-25  No. 2167  Garfield doesn't like Christmas
2015-04-26  No. 2168  Your Guess Is As Good As Mine
2015-04-27  No. 2169  Arbucklean Cat: Garfield Rocks
2015-04-28  No. 2170  Another Reason to Have Adblock
2015-04-29  No. 2171  Quadrupedfield, 1978
2015-04-30  No. 2172  Not Much Room To Talk Backfield
2015-05-01  No. 2173  Inverse Snark Field
2015-05-02  No. 2174  The Slow Path
2015-05-03  No. 2175  Square Root Of Minus Sunim Fo Toor Erauqs
2015-05-04  No. 2176  Garfield minus Garfield plus Sketchfield
2015-05-05  No. 2177  Nightmare Garfield
2015-05-06  No. 2178  Garflub
2015-05-07  No. 2179  Exty Six
2015-05-08  No. 2180  Smashfield
2015-05-09  No. 2181  Binky Cereal: Binky Puffs Rule
2015-05-10  No. 2182  I think I'll clean his clock
2015-05-11  No. 2183  The Arbuckle Parabox
2015-05-12  No. 2184  Damm, I'm mad
2015-05-13  No. 2185  Dear Satan
2015-05-14  No. 2186  Attached Photos
2015-05-15  No. 2187  Three Panel Garfield
2015-05-16  No. 2188  Plate
2015-05-17  No. 2189  Photograph
2015-05-18  No. 2190  Detente Flowers
2015-05-19  No. 2191  Getting Garfield Past the Radar
2015-05-20  No. 2192  Garfield Plus Corrected Gastronomy Taxonomy
2015-05-21  No. 2193  All You Need is Me
2015-05-22  No. 2194  Bigger
2015-05-23  No. 2195  Garfield plus the Drawing Game
2015-05-24  No. 2196  Garfield Carlos Williams
2015-05-25  No. 2197  Marshmallow Bomb
2015-05-26  No. 2198  Zalgo Garfield 6
2015-05-27  No. 2199  Bubba
2015-05-28  No. 2200  Vine
2015-05-29  No. 2201  Frozen Stiff
2015-05-30  No. 2202  3 Months or 3,000 Lasagnas
2015-05-31  No. 2203  Doubly Comfortable
2015-06-01  No. 2204  Garfield: His 2ne1 Lives
2015-06-02  No. 2205  Super Garfield 3D World
2015-06-03  No. 2206  Odie's Girlfriend
2015-06-04  No. 2207  Yarn Minus Garfield
2015-06-05  No. 2208  Apocalypse Meow
2015-06-06  No. 2209  Garfield and translation bad slowly
2015-06-07  No. 2210  Garfield Minus Any Attempt at Humour
2015-06-08  No. 2211  Garfield's Morning Routine
2015-06-09  No. 2212  Try Not To Rush
2015-06-10  No. 2213  Garfield Plus an Absolutely Horrible Movie
2015-06-11  No. 2214  Square Root of Minus Garfield in 2053
2015-06-12  No. 2215  Taco Tuesday
2015-06-13  No. 2216  Vegan Jon
2015-06-14  No. 2217  Wait for it...
2015-06-15  No. 2218  34 Beat Panels
2015-06-16  No. 2219  Girlfriend
2015-06-17  No. 2220  Garfield minus the magical disappearing food
2015-06-18  No. 2221  Beware of Fog
2015-06-19  No. 2222  Plant
2015-06-20  No. 2223  Future Self
2015-06-21  No. 2224  Coffees
2015-06-22  No. 2225  Bloons Tower Defensefield
2015-06-23  No. 2226  The Big Bright Green Garfield Machine
2015-06-24  No. 2227  Garfield in 2053, Part %%SYNTAX_ERROR%%
2015-06-25  No. 2228  Garfield Plus Donkey Kong
2015-06-26  No. 2229  Jon was wrong
2015-06-27  No. 2230  Grump Out!
2015-06-28  No. 2231  Zalgo Garfield 7
2015-06-29  No. 2232  Smile.garfield
2015-06-30  No. 2233  Garfield Randomizer Lost In Translation Minus Garfield
2015-07-01  No. 2234  Spritefield
2015-07-02  No. 2235  Square Root of Minus Garfield: The Abridged Series
2015-07-03  No. 2236  Million Dollar Cat
2015-07-04  No. 2237  Literal Square Root of Minus Garfield
2015-07-05  No. 2238  Garfield Entertainment System
2015-07-06  No. 2239  So Long, And Thanks For All The Fish
2015-07-07  No. 2240  Garfield of Thrones S01E01
2015-07-08  No. 2241  The Naming of Cats
2015-07-09  No. 2242  Gorillafield
2015-07-10  No. 2243  Big Tree
2015-07-11  No. 2244  Crooked
2015-07-12  No. 2245  Garfield's Actual Theme Song
2015-07-13  No. 2246  Garfield Minus Any Kind of Science Plus Honesty
2015-07-14  No. 2247  Feng Shui
2015-07-15  No. 2248  All About That Garfield
2015-07-16  No. 2249  Gum
2015-07-17  No. 2250  Hovering Sombrero
2015-07-18  No. 2251  Moebius Strip Strip
2015-07-19  No. 2252  Magarfitteld
2015-07-20  No. 2253  Expire
2015-07-21  No. 2254  Garfield Plus Potentially Butchered Blissymbolics
2015-07-22  No. 2255  Not So Grump?
2015-07-23  No. 2256  DeepDreamfield
2015-07-24  No. 2257  Pie Form Coming Right Up
2015-07-25  No. 2258  Fatso
2015-07-26  No. 2259  Platefield
2015-07-27  No. 2260  Garfield plus all-too-predictable consequences
2015-07-28  No. 2261  Irma Juice
2015-07-29  No. 2262  Reversed Decayfield Redux
2015-07-30  No. 2263  First Garfield in Haiku
2015-07-31  No. 2264  Gnorm Gnatfield
2015-08-01  No. 2265  Garfield Abridged
2015-08-02  No. 2266  Public Service Announcement
2015-08-03  No. 2267  Anti-Jon's Donut
2015-08-04  No. 2268  LaserDisc
2015-08-05  No. 2269  Minus Jon
2015-08-06  No. 2270  And the winner is...
2015-08-07  No. 2271  :D
2015-08-08  No. 2272  Naugahyde
2015-08-09  No. 2273  3:16, Five Years Later
2015-08-10  No. 2274  Mice Mice Baby
2015-08-11  No. 2275  Coming Down With A Code
2015-08-12  No. 2276  Garfield Minus Cartoon Physics
2015-08-13  No. 2277  Buttered Cat Paradox
2015-08-14  No. 2278  Day Tripper
2015-08-15  No. 2279  Joe Root of Minus Garfield
2015-08-16  No. 2280  Pizza Number One
2015-08-17  No. 2281  Garcissism
2015-08-18  No. 2282  Garfield plus a twenty years old advert
2015-08-19  No. 2283  XXXL
2015-08-20  No. 2284  Garfield Must Die(t)!
2015-08-21  No. 2285  Omeglefield 2
2015-08-22  No. 2286  Not the Bees!
2015-08-23  No. 2287  Romancinta
2015-08-24  No. 2288  Much Better
2015-08-25  No. 2289  Fibbon' Fishy
2015-08-26  No. 2290  Duplifield
2015-08-27  No. 2291  Jon gets hit by a car
2015-08-28  No. 2292  Stick 'em Up
2015-08-29  No. 2293  Garfield Minus A "Looky"
2015-08-30  No. 2294  Absolutely Nothing
2015-08-31  No. 2295  Eleven Seconds
2015-09-01  No. 2296  Grin Reaper
2015-09-02  No. 2297  Garf Done Gone
2015-09-03  No. 2298  Night Garfield 2
2015-09-04  No. 2299  Full Circle-field
2015-09-05  No. 2300  The Treachery of Confectionery
2015-09-06  No. 2301  Zalgo Garfield 8
2015-09-07  No. 2302  Simple Re-contextualization 2: Straight Inversion
2015-09-08  No. 2303  The Pinnacle of Wit
2015-09-09  No. 2304  Square Root of Minus Grafield
2015-09-10  No. 2305  Average
2015-09-11  No. 2306  Hey! Garfield! Remember Me?
2015-09-12  No. 2307  Garfield Near a Black Hole
2015-09-13  No. 2308  Well, that's my guess anyway
2015-09-14  No. 2309  Garfield's Intern
2015-09-15  No. 2310  ...Is A Place On Earth
2015-09-16  No. 2311  The Empire of Mice
2015-09-17  No. 2312  A More Innocent Explanation
2015-09-18  No. 2313  Garflub 2
2015-09-19  No. 2314  Viral
2015-09-20  No. 2315  Wise Decision
2015-09-21  No. 2316  Garfield's Love Life
2015-09-22  No. 2317  Liz 4 Dinner
2015-09-23  No. 2318  To Serve
2015-09-24  No. 2319  The Last Jon on Earth
2015-09-25  No. 2320  Detente Flowers
2015-09-26  No. 2321  Video Gamefield
2015-09-27  No. 2322  Wuthering Fields
2015-09-28  No. 2323  Single Orange Cat
2015-09-29  No. 2324  Grandpa
2015-09-30  No. 2325  Send In The Clones
2015-10-01  No. 2326  Splatoonfield
2015-10-02  No. 2327  Romance
2015-10-03  No. 2328  Simple Recontextualization: Changing Nouns
2015-10-04  No. 2329  The world's fastest snail
2015-10-05  No. 2330  Milk Pic
2015-10-06  No. 2331  Game Cat
2015-10-07  No. 2332  Garfield Plus Jägerdraught
2015-10-08  No. 2333  He'll be smelting iron to pigs any minute now
2015-10-09  No. 2334  Fatter
2015-10-10  No. 2335  Dialogue Contest
2015-10-11  No. 2336  Spider in Red
2015-10-12  No. 2337  Scrapefield
2015-10-13  No. 2338  Garde au Mur
2015-10-14  No. 2339  Walking Backwards
2015-10-15  No. 2340  A Brave Cleaner, Diagrams, Equations, Food, & Garfield
2015-10-16  No. 2341  Garfield plus Time
2015-10-17  No. 2342  Square Root of Minus Skeeter
2015-10-18  No. 2343  Existential Crisisfield
2015-10-19  No. 2344  New Super Garfield Bros.
2015-10-20  No. 2345  Odie's Boyfriend
2015-10-21  No. 2346  Spot The Difference With Garfield 7
2015-10-22  No. 2347  No Romance
2015-10-23  No. 2348  Twin Peaksfield
2015-10-24  No. 2349  Coffield
2015-10-25  No. 2350  Indiana Mouse and the Repast Crusade
2015-10-26  No. 2351  Dialogue Contest - Result
2015-10-27  No. 2352  Selfie-Actualisation
2015-10-28  No. 2353  Discredited Memes
2015-10-29  No. 2354  Transfunny Gags! 1
2015-10-30  No. 2355  Garfield Gives You A Tour Of His World
2015-10-31  No. 2356  Zalgo Garfield 9
2015-11-01  No. 2357  Garfield Quest 1: The Lasagna Encounter
2015-11-02  No. 2358  3x3field
2015-11-03  No. 2359  Garfield Minus Punchlines
2015-11-04  No. 2360  Scrambled & Spellchecked
2015-11-05  No. 2361  The consequences of not having a panel border
2015-11-06  No. 2362  Obviously
2015-11-07  No. 2363  Bootstrap Garfield
2015-11-08  No. 2364  Feed Me!
2015-11-09  No. 2365  Bedtime Story
2015-11-10  No. 2366  Fourth Opinion
2015-11-11  No. 2367  As A Vet
2015-11-12  No. 2368  Why So Serious? - Unofficial Take
2015-11-13  No. 2369  Simple Re-contextualization 4: Change of Scene
2015-11-14  No. 2370  All the Answers
2015-11-15  No. 2371  Milk's Least Favorite Cookie
2015-11-16  No. 2372  Monday Night Football
2015-11-17  No. 2373  Sailor Jon
2015-11-18  No. 2374  PUNT!
2015-11-19  No. 2375  You're in Trouble, Jon
2015-11-20  No. 2376  Dusty Springfield
2015-11-21  No. 2377  Bored
2015-11-22  No. 2378  Eyes Wide Field
2015-11-23  No. 2379  Garfield Plus Math Assignment
2015-11-24  No. 2380  The most she will do is throw shadows at you but she's always a woman to meme
2015-11-25  No. 2381  WHAT A TWIST!
2015-11-26  No. 2382  Strawberry Shortcake
2015-11-27  No. 2383  Time
2015-11-28  No. 2384  Garfield Attempts To Delay The Inevitable
2015-11-29  No. 2385  For Want of a Grip
2015-11-30  No. 2386  Omeglefield 3
2015-12-01  No. 2387  Garfield Minus Garfield Plus Grafield
2015-12-02  No. 2388  Expandfield
2015-12-03  No. 2389  Calabi-Meow
2015-12-04  No. 2390  Super Garfield Kart
2015-12-05  No. 2391  Depressingfield
2015-12-06  No. 2392  Bat
2015-12-07  No. 2393  Grafield Meets Garfield
2015-12-08  No. 2394  37th Birthday Special Redux
2015-12-09  No. 2395  Nostalgiafield
2015-12-10  No. 2396  It Can Be Hugs Time Now?
2015-12-11  No. 2397  And cats?
2015-12-12  No. 2398  This One Is Garbage
2015-12-13  No. 2399  Smaller
2015-12-14  No. 2400  Garfield Minus Garfield, Value Added: Blah Blah Blah
2015-12-15  No. 2401  Garfield Plus Nudism
2015-12-16  No. 2402  Pictorial Garfield
2015-12-17  No. 2403  Japanfield
2015-12-18  No. 2404  Turn Around, Bright Eyes
2015-12-19  No. 2405  Garfield Plus PawSense
2015-12-20  No. 2406  Fench TV
2015-12-21  No. 2407  Hug
2015-12-22  No. 2408  Dark Side of the Lasagne: Christmas Edition
2015-12-23  No. 2409  A Good Bone
2015-12-24  No. 2410  Another Garkov
2015-12-25  No. 2411  Garfield in 2053: Christmas Special
2015-12-26  No. 2412  Stupid-Looking Snowman
2015-12-27  No. 2413  Garfield Kart 64
2015-12-28  No. 2414  Screen Capture, Screen Captured
2015-12-29  No. 2415  What Year Is It?
2015-12-30  No. 2416  Jon's Hallucination
2015-12-31  No. 2417  Not With a Bang
2016-01-01  No. 2418  Humor Recalibration
2016-01-02  No. 2419  Purple Stain
2016-01-03  No. 2420  Grootfield
2016-01-04  No. 2421  Garfield's Error Theatre #3
2016-01-05  No. 2422  My Neighbor Garfield
2016-01-06  No. 2423  Cleverfield
2016-01-07  No. 2424  MST3Kfield
2016-01-08  No. 2425  A different artist invades
2016-01-09  No. 2426  Jon and Calvin and Garfield
2016-01-10  No. 2427  Garfield Minus The Ability To See Frozen Thoughts
2016-01-11  No. 2428  Melon Collie
2016-01-12  No. 2429  Bloom County 2015field
2016-01-13  No. 2430  Passed
2016-01-14  No. 2431  Sparkyfield
2016-01-15  No. 2432  Rock you like a cross-check
2016-01-16  No. 2433  Garfield Plus Googly Eyes
2016-01-17  No. 2434  Double Hockey Sticks
2016-01-18  No. 2435  Garfey Cyrus
2016-01-19  No. 2436  Square Root of The Adventures of Minus Business Garfield
2016-01-20  No. 2437  You're a Peach, Irma!
2016-01-21  No. 2438  Garfield Minus Garfield Plus Donut
2016-01-22  No. 2439  Garfield and a Half, or, Garfield Is Better Than You At Everything
2016-01-23  No. 2440  Square Root of Minus Ebert
2016-01-24  No. 2441  Autsch!
2016-01-25  No. 2442  Grassfield
2016-01-26  No. 2443  Brawl in the Family Minus King Dedede
2016-01-27  No. 2444  Mike, Lu and __; or, "The Suite Life of Zack and Cody" Reference Gone Horribly Wrong
2016-01-28  No. 2445  Garfield plus Time
2016-01-29  No. 2446  Garfield Plus Time - Value Added: A Loyal Pet
2016-01-30  No. 2447  Reason
2016-01-31  No. 2448  Jump-scarefield
2016-02-01  No. 2449  Sunny Sundae Smile
2016-02-02  No. 2450  Garfield is Allergic to Jon
2016-02-03  No. 2451  Bachelor Horror Theater
2016-02-04  No. 2452  Still No Romance
2016-02-05  No. 2453  Garfield With A Slightly Changed Setup
2016-02-06  No. 2454  Make It Big
2016-02-07  No. 2455  Down!
2016-02-08  No. 2456  Ice Ice Baby
2016-02-09  No. 2457  Lyrical
2016-02-10  No. 2458  Hardware Store
2016-02-11  No. 2459  And Tonight's Special Guest Star Is...
2016-02-12  No. 2460  VHSfield
2016-02-13  No. 2461  Jon's Boo-Boo, Reversed
2016-02-14  No. 2462  RIP Jon Arbuckle
2016-02-15  No. 2463  Misanthrope Supreme Garfield
2016-02-16  No. 2464  Sometimes Your Dish Bleeds More Than Your Heart
2016-02-17  No. 2465  Mysterious Cone!
2016-02-18  No. 2466  Garfield the Colbert Fan
2016-02-19  No. 2467  Off Route 109
2016-02-20  No. 2468  Coffie
2016-02-21  No. 2469  Windows 7-Field
2016-02-22  No. 2470  We stand on fence for thee
2016-02-23  No. 2471  Trollfield
2016-02-24  No. 2472  Making Garfield Slightly Weirder
2016-02-25  No. 2473  Scrambled TV
2016-02-26  No. 2474  U.S. Acres Crossover
2016-02-27  No. 2475  Garfield's Dessert
2016-02-28  No. 2476  Garflub 3: The First Garflub
2016-02-29  No. 2477  Garfield Minus Jon Plus Orange Ball
2016-03-01  No. 2478  "Dark Side of the Lasagne" In One Panel
2016-03-02  No. 2479  Underfield
2016-03-03  No. 2480  Gartale
2016-03-04  No. 2481  Underfield
2016-03-05  No. 2482  Miiverse
2016-03-06  No. 2483  Spot The Difference With Garfield 8
2016-03-07  No. 2484  Square Root of Garfield Plus Drawception
2016-03-08  No. 2485  A man with a fork in a world of soup
2016-03-09  No. 2486  The Four-Day Snail
2016-03-10  No. 2487  Title Panel Coloration Garfield
2016-03-11  No. 2488  [This Strip Has Been Copyright Claimed By Nintendo]
2016-03-12  No. 2489  [This Strip Has Been Copyright Claimed By Crazy56U]
2016-03-13  No. 2490  Garfield Minus Garfield Plus Garfield
2016-03-14  No. 2491  (Slightly) Less Humor, More Story: Shedding Edition
2016-03-15  No. 2492  Garfield Plus Accurately-Labeled Violence
2016-03-16  No. 2493  The Treachery of Confectionery, Fixed
2016-03-17  No. 2494  Jon's Instrumentality
2016-03-18  No. 2495  Babelfield
2016-03-19  No. 2496  The Return of Eyeballfield
2016-03-20  No. 2497  Stressfield
2016-03-21  No. 2498  Jon's Incineration
2016-03-22  No. 2499  Bad bad, bad bad behaviour
2016-03-23  No. 2500  SRoMG 1 of 1 of #1, 2 of 2 of #2, and 3 of 3 of #3
2016-03-24  No. 2501  Garfolution
2016-03-25  No. 2502  Jon I think was his name.
2016-03-26  No. 2503  Garfield Minus Lack of Sense
2016-03-27  No. 2504  You're Just Too Good To Be True
2016-03-28  No. 2505  Horrible Place
2016-03-29  No. 2506  Out
2016-03-30  No. 2507  Shifted
2016-03-31  No. 2508  Garfield Minus Arbuckle
2016-04-01  No. 2509  An Undertale Of Two Kitties
2016-04-02  No. 2510  Wacky Eyes Garfield
2016-04-03  No. 2511  "What Year Is It?" Plus Accuracy
2016-04-04  No. 2512  Scriptfield
2016-04-05  No. 2513  Kiss me, you fool!
2016-04-06  No. 2514  Imagine Garfields
2016-04-07  No. 2515  MegaGarufirodo
2016-04-08  No. 2516  Brownie points
2016-04-09  No. 2517  Stand-In Delivers
2016-04-10  No. 2518  asdfgarfield
2016-04-11  No. 2519  Garfdust
2016-04-12  No. 2520  Square Root of Minus Garfield No. 1 Special Edition High Definition Re-Release
2016-04-13  No. 2521  Facebomb
2016-04-14  No. 2522  A Treaty
2016-04-15  No. 2523  Literalfield
2016-04-16  No. 2524  Satisfaction
2016-04-17  No. 2525  Bury My Garfield At Wounded Knee
2016-04-18  No. 2526  BlondE!
2016-04-19  No. 2527  I fed up with this worl
2016-04-20  No. 2528  ?comic=0field
2016-04-21  No. 2529  Simple Re-contextualization 5: Positivity Enhancement
2016-04-22  No. 2530  Disaster Days with Comedic Ending
2016-04-23  No. 2531  Das Neue Rathaus
2016-04-24  No. 2532  Take That II (Just Another Day in the Life of a Tabby Cat!)
2016-04-25  No. 2533  Rangerfield
2016-04-26  No. 2534  Spoot
2016-04-27  No. 2535  Garfield Figures Out the World Revolving Around Him
2016-04-28  No. 2536  In The Wrong Strip Again
2016-04-29  No. 2537  Square Root of Minus Garfield: The Abridged Series #2
2016-04-30  No. 2538  Pure imagination
2016-05-01  No. 2539  The Might Ea Might Ea-Boss-t Ones
2016-05-02  No. 2540  Garfield CD-i
2016-05-03  No. 2541  Komm, süsser Lasagne
2016-05-04  No. 2542  Before the horse
2016-05-05  No. 2543  Realisationfield
2016-05-06  No. 2544  Garfield, With Only One Word Changed
2016-05-07  No. 2545  Meme Eater
2016-05-08  No. 2546  Monday In The Dumps
2016-05-09  No. 2547  The Chronicles of Garnia
2016-05-10  No. 2548  2field Plus Punchlines
2016-05-11  No. 2549  My Reaction to Garfield Chickens Out Coming Out
2016-05-12  No. 2550  Garfield's Arm
2016-05-13  No. 2551  Imaginary Puzzle
2016-05-14  No. 2552  But This Wasn't One Of Them
2016-05-15  No. 2553  Tener Cuidado Con Lo Que Deseas
2016-05-16  No. 2554  DuckDuckGarfield
2016-05-17  No. 2555  Garfield Minus Feelings
2016-05-18  No. 2556  Waste of Sunday Space
2016-05-19  No. 2557  It's A Food
2016-05-20  No. 2558  Drowning Garfield
2016-05-21  No. 2559  Garfield in 2016
2016-05-22  No. 2560  Ventura Ventura Space People
2016-05-23  No. 2561  State of the Arbuckle
2016-05-24  No. 2562  Contagious
2016-05-25  No. 2563  Portalfield
2016-05-26  No. 2564  Ol' Lightning Wit
2016-05-27  No. 2565  Mornings
2016-05-28  No. 2566  Jon Piece
2016-05-29  No. 2567  Jon Arrrbuckle
2016-05-30  No. 2568  Garfield In 2053 Jumps The Shark
2016-05-31  No. 2569  A dull life
2016-06-01  No. 2570  EarthField
2016-06-02  No. 2571  A Perfect Day For Lasagnafish
2016-06-03  No. 2572  Garfield plus Garfield plus Garfield plus Garfield
2016-06-04  No. 2573  Obvious Pun (Mouse)
2016-06-05  No. 2574  A New Man
2016-06-06  No. 2575  Something Elsa Is Constantly Changing
2016-06-07  No. 2576  Coffee really does kills dogs
2016-06-08  No. 2577  Bananaman Begins
2016-06-09  No. 2578  Gotta feelin', gotta feelin', gotta feelin' like I'm paralysed
2016-06-10  No. 2579  Really, Erm... Dog-Hating, Cat. Meh.
2016-06-11  No. 2580  Misan[s]thropic Garfield
2016-06-12  No. 2581  Highfield
2016-06-13  No. 2582  Garfield Plus Bombermen
2016-06-14  No. 2583  Garfield Minus Three Filler Panels
2016-06-15  No. 2584  Garfield, Amethyst and Pearl
2016-06-16  No. 2585  Garfield Plus Night Vale
2016-06-17  No. 2586  If You Seek Odie
2016-06-18  No. 2587  Not-So-Darkfield
2016-06-19  No. 2588  Garf or Die
2016-06-20  No. 2589  Monty Garfield's Flying Circus
2016-06-21  No. 2590  Think of seven letters, begin and end with 'c'
2016-06-22  No. 2591  Garfield Minus Garfield Minus G, a, r, f, i, e, l, d
2016-06-23  No. 2592  Enough Dressing To Fill The Black Sea
2016-06-24  No. 2593  Garfield Plus Correct Hyphenation I
2016-06-25  No. 2594  Garfield In Alice
2016-06-26  No. 2595  SpongeField SquareCat
2016-06-27  No. 2596  John Garvoltafield
2016-06-28  No. 2597  Doog
2016-06-29  No. 2598  Symbolic Thoughts
2016-06-30  No. 2599  Ham Rap (Enjoy What You Do)
2016-07-01  No. 2600  2600
2016-07-02  No. 2601  But With A Whisker
2016-07-03  No. 2602  It's fun to swap words around!
2016-07-04  No. 2603  Garfield Plus 3 Previously Consumed Bottles
2016-07-05  No. 2604  Bananatime
2016-07-06  No. 2605  Played For Drama
2016-07-07  No. 2606  Garfield Minus Thought Bubble
2016-07-08  No. 2607  Garfield Plus Resignation To Fate
2016-07-09  No. 2608  Viewer Discretion Is Advised
2016-07-10  No. 2609  Garfield Minus Garfield And Jon
2016-07-11  No. 2610  Dg
2016-07-12  No. 2611  Underfield: A Time to Seek Therapy
2016-07-13  No. 2612  "Dark Side of Lasagne In One Panel" Scaled Up and Redrawn
2016-07-14  No. 2613  Tool-Assisted Garfield
2016-07-15  No. 2614  Rihannafield
2016-07-16  No. 2615  Garfield is a cat
2016-07-17  No. 2616  Excitement levels
2016-07-18  No. 2617  Doggone
2016-07-19  No. 2618  Don't Talk Just Kiss
2016-07-20  No. 2619  Donut
2016-07-21  No. 2620  Turbo-Tastic
2016-07-22  No. 2621  One Of These Month of No Sundays Strips Is Not Like The Others...
2016-07-23  No. 2622  Marching Home from the Donut Wars
2016-07-24  No. 2623  What Would Happen?
2016-07-25  No. 2624  Jon's Dungeon
2016-07-26  No. 2625  Rock-cat Jumps Aren't Cute
2016-07-27  No. 2626  Calculus in a Nutshell
2016-07-28  No. 2627  Bewear
2016-07-29  No. 2628  Another Step Further
2016-07-30  No. 2629  Liz Has Amnesia
2016-07-31  No. 2630  Action Hero
2016-08-01  No. 2631  Max Headfield
2016-08-02  No. 2632  Garfiend Folio
2016-08-03  No. 2633  Darn!
2016-08-04  No. 2634  The Real 37th Birthday Special - Too Old
2016-08-05  No. 2635  New Dress
2016-08-06  No. 2636  Garfield Plus Correct Hyphenation II
2016-08-07  No. 2637  Love life
2016-08-08  No. 2638  Walk This Way
2016-08-09  No. 2639  Naughty Garfield
2016-08-10  No. 2640  Mirror, Mirror
2016-08-11  No. 2641  Mirror, Mirror Redux
2016-08-12  No. 2642  Consistency
2016-08-13  No. 2643  Obvious Pun (Rush)
2016-08-14  No. 2644  Wargfield
2016-08-15  No. 2645  Garfield Plus Seriousness (8-Bit Style)
2016-08-16  No. 2646  Garfield-Kohai
2016-08-17  No. 2647  Ramirezfield
2016-08-18  No. 2648  Painfully Posh and Vivaciously Verbose Cartoonist Jon Arbuckle and Feline Garfield
2016-08-19  No. 2649  Purple Lint
2016-08-20  No. 2650  Ssst
2016-08-21  No. 2651  Galfierd
2016-08-22  No. 2652  Grafiedl
2016-08-23  No. 2653  加菲猫平衡
2016-08-24  No. 2654  Badly Translated Garfield 2: The Crocodiling
2016-08-25  No. 2655  There must be a higher Category Bo Mot ja palauttaa
2016-08-26  No. 2656  Now for Non-droid and jOS
2016-08-27  No. 2657  Garfield minus Garfield equals one Garfield
2016-08-28  No. 2658  Garfield Minus Dialogue
2016-08-29  No. 2659  Dumb Jon
2016-08-30  No. 2660  Grinfield Plus Punchline from #783
2016-08-31  No. 2661  xkcdfield: Sudo Edition
2016-09-01  No. 2662  Garfield Haikus Garfield
2016-09-02  No. 2663  Jon Is Un-Funnie; or, Garfield Minus Any Respect for the Classics
2016-09-03  No. 2664  Bod-acious
2016-09-04  No. 2665  Garfield's Ballet Saga
2016-09-05  No. 2666  Lasagnas & Litterboxes Revisited
2016-09-06  No. 2667  Poison
2016-09-07  No. 2668  Meme Eater Rememed
2016-09-08  No. 2669  Doge
2016-09-09  No. 2670  Action Hero 2.0
2016-09-10  No. 2671  Drilfield
2016-09-11  No. 2672  Spoon
2016-09-12  No. 2673  Garfield Minus Stomach
2016-09-13  No. 2674  Look Back in Languor
2016-09-14  No. 2675  Garfield's Apple
2016-09-15  No. 2676  Garfield Plus More Plausible Thief
2016-09-16  No. 2677  Garfield in 2053: Breakdown
2016-09-17  No. 2678  The End of Garfield, in 2053
2016-09-18  No. 2679  Kingofthehillfield
2016-09-19  No. 2680  Rilke's Panther
2016-09-20  No. 2681  Garfield is Wrong
2016-09-21  No. 2682  Garfield, Amethyst and Pearl Part 2
2016-09-22  No. 2683  Bananaman, Japanese Style
2016-09-23  No. 2684  I Want To Dance
2016-09-24  No. 2685  Pinkfield Strikes Again
2016-09-25  No. 2686  Fantasy Skelefield
2016-09-26  No. 2687  Works as advertised?
2016-09-27  No. 2688  Not Zalgo Garfield
2016-09-28  No. 2689  Human Hair
2016-09-29  No. 2690  Garfield Plus Suspense
2016-09-30  No. 2691  Bibs and Bullets
2016-10-01  No. 2692  Once Again, Your Guess Is As Good As Mine
2016-10-02  No. 2693  Garfield Plus Correct Hyphenation III
2016-10-03  No. 2694  Depressed Luigi (Not Actual)
2016-10-04  No. 2695  The Impending Collapse Of It All
2016-10-05  No. 2696  Scaredy Jumped
2016-10-06  No. 2697  Banana Man, Japanese Style, in Japanese
2016-10-07  No. 2698  Butterfield
2016-10-08  No. 2699  Pet Sounds
2016-10-09  No. 2700  A Garfield Comic
2016-10-10  No. 2701  I Like Indiana and Indiana Likes Me
2016-10-11  No. 2702  Cats Do Strange Things
2016-10-12  No. 2703  Hug
2016-10-13  No. 2704  The Most Divisive Strip of Square Root Of Minus Garfield Ever!
2016-10-14  No. 2705  Slow Jog
2016-10-15  No. 2706  Garfield Made Slightly Less Cute
2016-10-16  No. 2707  Rebus
2016-10-17  No. 2708  Uncle Roy & Binky
2016-10-18  No. 2709  Ragfield, as presented from that different artist who tried to invade earlier, way back in comic 2425!
2016-10-19  No. 2710  Anything But Johnny Test!
2016-10-20  No. 2711  Garfield Papyrus Garfield
2016-10-21  No. 2712  Underfield, Overfield, Wombling Free
2016-10-22  No. 2713  Five Nights at Garfield's
2016-10-23  No. 2714  Garf Theory: Garfield Predicted Lady Gaga, ZOMG!
2016-10-24  No. 2715  Pudding Pops 2: Frosting Pudding Pops
2016-10-25  No. 2716  Bad time
2016-10-26  No. 2717  Arrested Developmentfield
2016-10-27  No. 2718  Insurmountable Waist-High Fence
2016-10-28  No. 2719  Color plus Black and White
2016-10-29  No. 2720  Nope, We're Still Good
2016-10-30  No. 2721  Longer
2016-10-31  No. 2722  Garfield Minus Jealousy Plus Sadness
2016-11-01  No. 2723  Lizfield
2016-11-02  No. 2724  Teaser
2016-11-03  No. 2725  Jon's Place
2016-11-04  No. 2726  Unguarded Explosion
2016-11-05  No. 2727  Prehistoric Garfasaurus
2016-11-06  No. 2728  Jon's Aunt Gussie turns the air blue
2016-11-07  No. 2729  Catchless
2016-11-08  No. 2730  Checkarooni
2016-11-09  No. 2731  Autocorrelated Wallpaper
2016-11-10  No. 2732  Wrong Dummy
2016-11-11  No. 2733  Garfield Plus Diversity
2016-11-12  No. 2734  Garfield as a Political Cartoon
2016-11-13  No. 2735  Caped Avenger
2016-11-14  No. 2736  Spider in Red, Literal Form
2016-11-15  No. 2737  Eighth Anniversary
2016-11-16  No. 2738  Garfield Plus Blood
2016-11-17  No. 2739  Derangedfield
2016-11-18  No. 2740  Bananario Kart
2016-11-19  No. 2741  Petool
2016-11-20  No. 2742  Casual Milk
2016-11-21  No. 2743  Dimensionfield
2016-11-22  No. 2744  Garfield's Bedtime Stories
2016-11-23  No. 2745  Garfield Plus Dedenne
2016-11-24  No. 2746  JiggilyField
2016-11-25  No. 2747  Detente
2016-11-26  No. 2748  Gar
2016-11-27  No. 2749  Delta
2016-11-28  No. 2750  Garfield in 2053 Minus Garfield
2016-11-29  No. 2751  Jogging
2016-11-30  No. 2752  Darkfield 2
2016-12-01  No. 2753  Garfield Adventure
2016-12-02  No. 2754  Polka Palace
2016-12-03  No. 2755  Love It or Hate It
2016-12-04  No. 2756  Nice Looking Tie, Updated
2016-12-05  No. 2757  Smackfield
2016-12-06  No. 2758  Garfield Dies... Again
2016-12-07  No. 2759  Whatever happened to Fido Dido's Fido?
2016-12-08  No. 2760  Samples
2016-12-09  No. 2761  Oh, Lawsey, Lawsey, Lawsey...
2016-12-10  No. 2762  Garfield Minus Almost Everything
2016-12-11  No. 2763  Scarfield
2016-12-12  No. 2764  The Darkness consumed your pudding pops
2016-12-13  No. 2765  The Car-tuner in Action
2016-12-14  No. 2766  Nihilistic
2016-12-15  No. 2767  Jon's a Jerk
2016-12-16  No. 2768  More Beautiful Inlawfield
2016-12-17  No. 2769  Garfield in Denial
2016-12-18  No. 2770  Longer - Up to Eleven
2016-12-19  No. 2771  Potty Sunday
2016-12-20  No. 2772  McCloudfield
2016-12-21  No. 2773  End of the Worldfield II
2016-12-22  No. 2774  Ratings War Corrected
2016-12-23  No. 2775  Chicken Man Rises
2016-12-24  No. 2776  Wishmas
2016-12-25  No. 2777  Christmas at Ground Zero
2016-12-26  No. 2778  Super Garfield Advance 2: Super Garfield Land
2016-12-27  No. 2779  The Garfield Circus
2016-12-28  No. 2780  Cyanide and Garfieldness
2016-12-29  No. 2781  Reverse Image Garfield
2016-12-30  No. 2782  Make like a leaf and tweet
2016-12-31  No. 2783  Boring New Year
2017-01-01  No. 2784  2017 Will Be Better
2017-01-02  No. 2785  Low expectations
2017-01-03  No. 2786  White Shirt
2017-01-04  No. 2787  Milli Garfilli
2017-01-05  No. 2788  The Dead Past
2017-01-06  No. 2789  Garfearth
2017-01-07  No. 2790  Days Of Rotated Punchlines Seven
2017-01-08  No. 2791  Screen Capture, Screen Captured, Screen Captured
2017-01-09  No. 2792  QWERTY
2017-01-10  No. 2793  Garfield Made Cuter
2017-01-11  No. 2794  Garfield plus flavor transcript
2017-01-12  No. 2795  Garfshifter
2017-01-13  No. 2796  Could Be An Attorney
2017-01-14  No. 2797  Garfield mute mode
2017-01-15  No. 2798  Stagnant Camera
2017-01-16  No. 2799  Original, Original Strip
2017-01-17  No. 2800  DeepStylefield
2017-01-18  No. 2801  DeepDream Garfield
2017-01-19  No. 2802  Hats Off To Pharrell
2017-01-20  No. 2803  Nixon
2017-01-21  No. 2804  A rather chilly, yet relatively normal morning in the Arbuckle household, with no horror or monophobia at all
2017-01-22  No. 2805  Whatever Gets You Thru The Night
2017-01-23  No. 2806  Does that include Odie?
2017-01-24  No. 2807  Experimental Music Garfield 1
2017-01-25  No. 2808  Wonderful Wiping
2017-01-26  No. 2809  Square Root of Multiplied Garfield
2017-01-27  No. 2810  Garfield Alone
2017-01-28  No. 2811  Take That! Bait
2017-01-29  No. 2812  Meta Commentary
2017-01-30  No. 2813  Joke
2017-01-31  No. 2814  Jon the Coffee Addict
2017-02-01  No. 2815  Square Root of Garfield and Friends
2017-02-02  No. 2816  Another Dismal February
2017-02-03  No. 2817  Depressed
2017-02-04  No. 2818  Newspaperfield
2017-02-05  No. 2819  Odie in the Superbowl spirit
2017-02-06  No. 2820  Et tu, Puyo Pop?
2017-02-07  No. 2821  Blunt cat the Fifth: Send my (Finale)
2017-02-08  No. 2822  Forgoing Faded Milk
2017-02-09  No. 2823  Garfield Minus Plot
2017-02-10  No. 2824  Garfield Minus Characters That Have Been Trapped Inside A Comic Strip As Ironic Punishment For Unspeakable Crimes
2017-02-11  No. 2825  Garfield Minus Tomato Paste
2017-02-12  No. 2826  Garfield's Crush Parody!
2017-02-13  No. 2827  The Incredible Alternate Explanation Of The Joke! Or: Shrinky Dink
2017-02-14  No. 2828  Garfield minus Garfield plus Door to the Afterlife
2017-02-15  No. 2829  Cute Eye Garfield
2017-02-16  No. 2830  Garfield vs Lemmings
2017-02-17  No. 2831  Encyclopedia Brown (Is Not in This Strip)
2017-02-18  No. 2832  Garfield Hates Mustard
2017-02-19  No. 2833  Bribe
2017-02-20  No. 2834  Ia Ia
2017-02-21  No. 2835  Garfield Plus Quality Control 2
2017-02-22  No. 2836  Up to Beyond Eleven Plus One More
2017-02-23  No. 2837  Thanks For the Memeries
2017-02-24  No. 2838  DVD Fun
2017-02-25  No. 2839  Uptown Funkfield
2017-02-26  No. 2840  Supertaskfield
2017-02-27  No. 2841  agagag
2017-02-28  No. 2842  Bill
2017-03-01  No. 2843  Pooky Likes it Hot
2017-03-02  No. 2844  Odie Talks
2017-03-03  No. 2845  Zalgo Garfield Numero Diez
2017-03-04  No. 2846  Spider's Pride
2017-03-05  No. 2847  Quicker Sunday Quickies
2017-03-06  No. 2848  Blending Since '78
2017-03-07  No. 2849  Newspaperfield II
2017-03-08  No. 2850  Text Message Edition
2017-03-09  No. 2851  Glory To Garstotzka
2017-03-10  No. 2852  Eight Words That Can Bring An Anime Fan To Utter Despair
2017-03-11  No. 2853  Spot The Difference: Auto-Correlation Edition
2017-03-12  No. 2854  Uh Oh
2017-03-13  No. 2855  Lizfield: Diet
2017-03-14  No. 2856  Eek
2017-03-15  No. 2857  Get Lucky
2017-03-16  No. 2858  Quicker Temper
2017-03-17  No. 2859  Jon Minus Imagination
2017-03-18  No. 2860  Ghostfield
2017-03-19  No. 2861  A Newman
2017-03-20  No. 2862  I told my mother that I'd never make a wax jam
2017-03-21  No. 2863  Forgot I Could Walk
2017-03-22  No. 2864  The WE'RE BACHELORS, BABY Sticker!
2017-03-23  No. 2865  Burgertime
2017-03-24  No. 2866  The Final Pudding Pops Joke
2017-03-25  No. 2867  Tacos Rule
2017-03-26  No. 2868  Dilbert stopped making pudding pops
2017-03-27  No. 2869  Garfield's Seeming Arithmophobia
2017-03-28  No. 2870  ...
2017-03-29  No. 2871  Remains
2017-03-30  No. 2872  At the End of His...Sweater?
2017-03-31  No. 2873  Garlandfield
2017-04-01  No. 2874  April Fools!
2017-04-02  No. 2875  #SELFIE
2017-04-03  No. 2876  The Life of Lyman
2017-04-04  No. 2877  Experimental Music Garfield 2
2017-04-05  No. 2878  Garfield: The Movie Scene
2017-04-06  No. 2879  Garfield As _________
2017-04-07  No. 2880  Regrets
2017-04-08  No. 2881  Hot Pepper Eating Contest
2017-04-09  No. 2882  I Love You Coffee
2017-04-10  No. 2883  "We're Bachelors, Baby" but every time they say "bachelors" it gets faster
2017-04-11  No. 2884  One Long Movie
2017-04-12  No. 2885  Business is Booming
2017-04-13  No. 2886  An Inevitable Sequel To #2691
2017-04-14  No. 2887  JInx-Boy Jon
2017-04-15  No. 2888  Neon Night Garfields
2017-04-16  No. 2889  Garfield Minus Garfield Garfield Garfield Minus Garfield
2017-04-17  No. 2890  Mine
2017-04-18  No. 2891  Garfield Bends The Space Time Continuum
2017-04-19  No. 2892  Garfield Plus Stupidity
2017-04-20  No. 2893  Limited Edition Silver-Embossed Comic
2017-04-21  No. 2894  Garfield With Children
2017-04-22  No. 2895  Garfield Others
2017-04-23  No. 2896  Valor Killed the Cat
2017-04-24  No. 2897  Jon Has Stickphobia
2017-04-25  No. 2898  Garfield tells a running gag
2017-04-26  No. 2899  Looks Like He Just Got Remaindered
2017-04-27  No. 2900  Twerk
2017-04-28  No. 2901  Where's Garfield? Cross-Correlation Image Search
2017-04-29  No. 2902  The Dead Future Redux
2017-04-30  No. 2903  Exploding Spiders
2017-05-01  No. 2904  The Property of Garfield
2017-05-02  No. 2905  Psychic Jon
2017-05-03  No. 2906  An Unfunny, Blatantly Obvious, and Easily Predictable Joke
2017-05-04  No. 2907  Jonstown
2017-05-05  No. 2908  Lasagnas & Litterboxes Re-Revisited
2017-05-06  No. 2909  Starfield
2017-05-07  No. 2910  The Order of Dinner
2017-05-08  No. 2911  Lucky that my Nermal's small and humble so you don't confuse him with Garfield
2017-05-09  No. 2912  No he's-a not, he's-a wearing a neck-a-tie!
2017-05-10  No. 2913  Mitosis
2017-05-11  No. 2914  Variations on a Window
2017-05-12  No. 2915  Garfield As _________
2017-05-13  No. 2916  Goodbye, Lyman
2017-05-14  No. 2917  Garfield Sketched
2017-05-15  No. 2918  Pupilfield
2017-05-16  No. 2919  Spot the Difference With Garfield 9: I Don't Do Livestock
2017-05-17  No. 2920  Alonzo
2017-05-18  No. 2921  Show Me
2017-05-19  No. 2922  Mouser
2017-05-20  No. 2923  Garfield Minus Garfield Beginnings
2017-05-21  No. 2924  Unteased
2017-05-22  No. 2925  I I I I I I I I I I said I wanna sit down
2017-05-23  No. 2926  Garfd
2017-05-24  No. 2927  Thinking of otters
2017-05-25  No. 2928  Jon the Bully
2017-05-26  No. 2929  Infinite Jonst
2017-05-27  No. 2930  Disgustingly Logical Garfield
2017-05-28  No. 2931  A Long Nap
2017-05-29  No. 2932  Reaperfield
2017-05-30  No. 2933  Ask Me Another
2017-05-31  No. 2934  Asleep
2017-06-01  No. 2935  Irregular Callback!
2017-06-02  No. 2936  The Garfield Story
2017-06-03  No. 2937  The Mustache
2017-06-04  No. 2938  Aisle 10
2017-06-05  No. 2939  I'd have pegged him as more of a Gibson Flying V man
2017-06-06  No. 2940  LOL SAVAGE!!!
2017-06-07  No. 2941  Found By: Giygas
2017-06-08  No. 2942  Garfield Minus Garfield Plus A Tragic End
2017-06-09  No. 2943  An unguarded hamburger.
2017-06-10  No. 2944  Colour Correction
2017-06-11  No. 2945  Neon Garfesis
2017-06-12  No. 2946  Lemon 'n' Lyman
2017-06-13  No. 2947  Nermal Map
2017-06-14  No. 2948  Biff-Field, or Garfield to the Future
2017-06-15  No. 2949  B A C H E L O R S
2017-06-16  No. 2950  On the lawn of Hilbert's Hotel
2017-06-17  No. 2951  The GarB System
2017-06-18  No. 2952  Garfield As _________
2017-06-19  No. 2953  Puzzledfield
2017-06-20  No. 2954  Garfield's Birthday Rant
2017-06-21  No. 2955  Square Root of Additive Garfield
2017-06-22  No. 2956  A New Exploitable
2017-06-23  No. 2957  Liz REALLY Has Amnesia
2017-06-24  No. 2958  Fixed In-joke Theatre
2017-06-25  No. 2959  Cerebus Returns
2017-06-26  No. 2960  Antitrust
2017-06-27  No. 2961  Not flipping channels
2017-06-28  No. 2962  Alleycat Garfield
2017-06-29  No. 2963  Garfield Sketched #2
2017-06-30  No. 2964  Da Ba Dee Da Ba Daa
2017-07-01  No. 2965  Mercedes for Christmas
2017-07-02  No. 2966  Evil
2017-07-03  No. 2967  Gazorpazorpfield Minus Gazorpazorp
2017-07-04  No. 2968  The Intergalactic Consequences of Memes
2017-07-05  No. 2969  The Tragic Fate of Leon the Spider
2017-07-06  No. 2970  Garfield and Jon are Champs
2017-07-07  No. 2971  Negative Piecers
2017-07-08  No. 2972  Consider the Jonster
2017-07-09  No. 2973  Garfield Minus Snark
2017-07-10  No. 2974  Non-Stop Ecstatic Garfield
2017-07-11  No. 2975  First Battle of Breitengarfield
2017-07-12  No. 2976  A Really Ugly Lamp
2017-07-13  No. 2977  Well, I'll find someone that's not going Cheep-Cheep in the sales
2017-07-14  No. 2978  Even Easier Targets
2017-07-15  No. 2979  More Arbuckle, More Self-Hatred
2017-07-16  No. 2980  Demotivational Poster
2017-07-17  No. 2981  Snorefield
2017-07-18  No. 2982  Garfield Adjusted For Inflation
2017-07-19  No. 2983  Idiot Box
2017-07-20  No. 2984  Leave that Kitten Alone, Armone
2017-07-21  No. 2985  Excitingfield
2017-07-22  No. 2986  Magmafield
2017-07-23  No. 2987  Kanagawafield
2017-07-24  No. 2988  WikiMeow - 5 Ways To Survive A Tub of Ice Cream
2017-07-25  No. 2989  Garlicfield
2017-07-26  No. 2990  Garfield Sketched
2017-07-27  No. 2991  Garfield Minus Smart Joke
2017-07-28  No. 2992  Jim Davis' Lawyers
2017-07-29  No. 2993  Garfield's Horror Theater, Made For TV
2017-07-30  No. 2994  Please End My Suffering
2017-07-31  No. 2995  Garfield plus a very annoying commercial
2017-08-01  No. 2996  Garfield Blows Up
2017-08-02  No. 2997  Number one with a bullet
2017-08-03  No. 2998  Garfield's Mystery Science Theater
2017-08-04  No. 2999  MYSTERY SCIENCE THEATER 3000 INCOMING!
2017-08-05  No. 3000  Mystery Science Garfield 3000
2017-08-06  No. 3001  Paws Sells... but Who's Buying?
2017-08-07  No. 3002  Garfield in Lowercase
2017-08-08  No. 3003  And Its Name Was The Cole Slaw That Time Forgot
2017-08-09  No. 3004  SouthernHemispherefield
2017-08-10  No. 3005  TechnoGarfield: Let's Kick Garfield!
2017-08-11  No. 3006  King Kong vs. Godzilla
2017-08-12  No. 3007  Garfield Plus Budget Cuts
2017-08-13  No. 3008  Fridged
2017-08-14  No. 3009  Coke vs Pepsi, Garfield Style
2017-08-15  No. 3010  Garfield's Taking It Real Hard
2017-08-16  No. 3011  Aside Glance
2017-08-17  No. 3012  Jon Becomes Chica
2017-08-18  No. 3013  Just Pretend His Actual Name Is Jon
2017-08-19  No. 3014  Even Quicker Temper
2017-08-20  No. 3015  Unprovoked
2017-08-21  No. 3016  Hide
2017-08-22  No. 3017  Lon(g) Arbuckle
2017-08-23  No. 3018  Psychic Powers
2017-08-24  No. 3019  Changefield #10: Mondays
2017-08-25  No. 3020  Dab
2017-08-26  No. 3021  Paperboy Calls It Cats
2017-08-27  No. 3022  Catptcha
2017-08-28  No. 3023  Stringman
2017-08-29  No. 3024  Garfield With Slightly Increased Factual Content
2017-08-30  No. 3025  Rope Trick
2017-08-31  No. 3026  Stringman - HD Remake
2017-09-01  No. 3027  Fastest Snail Ever
2017-09-02  No. 3028  Lessin' Learned?
2017-09-03  No. 3029  No
2017-09-04  No. 3030  Danger Mice
2017-09-05  No. 3031  Garfield Sketched #4
2017-09-06  No. 3032  And there was not another cat in sight
2017-09-07  No. 3033  Like a big American car, but misspelled with a T
2017-09-08  No. 3034  minus garfield.
2017-09-09  No. 3035  Garfield doesn't like sockpuppets
2017-09-10  No. 3036  Get Younger
2017-09-11  No. 3037  Square Root of Minus Nemi
2017-09-12  No. 3038  Science, duuuude.
2017-09-13  No. 3039  Visual Punchline
2017-09-14  No. 3040  Jon's Stupidity Plus Another Dimension
2017-09-15  No. 3041  Ball Reversal
2017-09-16  No. 3042  Something Something Roof Comic
2017-09-17  No. 3043  Actually Showing the Punchline
2017-09-18  No. 3044  Jon's Meme Diary
2017-09-19  No. 3045  Rarfield
2017-09-20  No. 3046  And I Wanna Be Met With!
2017-09-21  No. 3047  An ACTOR, for crying out loud!
2017-09-22  No. 3048  Political Consultant Garfield
2017-09-23  No. 3049  Read Labels
2017-09-24  No. 3050  Gutter Mind
2017-09-25  No. 3051  I ate your dinner
2017-09-26  No. 3052  Shinin'
2017-09-27  No. 3053  Hello, Friend Garfield
2017-09-28  No. 3054  Smack Tip
2017-09-29  No. 3055  Yeech!
2017-09-30  No. 3056  A different type of meme
2017-10-01  No. 3057  Test Results
2017-10-02  No. 3058  Sniff
2017-10-03  No. 3059  My Birthday Strip Is Ruined
2017-10-04  No. 3060  Hatfield
2017-10-05  No. 3061  wakeupwiththekingfield.
2017-10-06  No. 3062  Garfiel Shoppe
2017-10-07  No. 3063  May Day!
2017-10-08  No. 3064  Caught in the Griddle
2017-10-09  No. 3065  Blizzard, Part 2
2017-10-10  No. 3066  Jon's Death Threat
2017-10-11  No. 3067  Case In Point
2017-10-12  No. 3068  Garfield in 2053: Birthday Edition
2017-10-13  No. 3069  Targfield
2017-10-14  No. 3070  Odie's an ECW Fan
2017-10-15  No. 3071  Garfield Sketched (Improved)
2017-10-16  No. 3072  The Enhance Button
2017-10-17  No. 3073  Jog Your Memory
2017-10-18  No. 3074  Blow Up a Pool
2017-10-19  No. 3075  Dan DeGarflo
2017-10-20  No. 3076  The Nickname of Arthur Lufthansa Technik
2017-10-21  No. 3077  Foobfield
2017-10-22  No. 3078  Bribe + Obligatory Meme
2017-10-23  No. 3079  A little bird told me...
2017-10-24  No. 3080  Even Real Life People Hate Stephano
2017-10-25  No. 3081  Garfield Minus Snail Plus Garfield
2017-10-26  No. 3082  Garfield with a Legitimized Concern
2017-10-27  No. 3083  Garfield Made His Own Cracktro
2017-10-28  No. 3084  Else
2017-10-29  No. 3085  It's "Saving", not "Savings"!
2017-10-30  No. 3086  Hop Up Here
2017-10-31  No. 3087  Devolution is Real-field
2017-11-01  No. 3088  Jon installs Windows 10
2017-11-02  No. 3089  Da Ba Dee Da Ba Daa
2017-11-03  No. 3090  Mandibles Bite, Dog
2017-11-04  No. 3091  Variation on Variations on a Window
2017-11-05  No. 3092  (Tell Me Why) I Don't Like Sundays, or, 31-Day Month of No Sundays
2017-11-06  No. 3093  Variations on a Ketchup Bottle
2017-11-07  No. 3094  Realistic Garfield
2017-11-08  No. 3095  I Am So Sorry
2017-11-09  No. 3096  I Thought This Should Probably Be Sent In
2017-11-10  No. 3097  Garfield Plus Quicksand
2017-11-11  No. 3098  Finger Licking: Good?
2017-11-12  No. 3099  Jon's Personal Cheer Reader
2017-11-13  No. 3100  A Braver Spider
2017-11-14  No. 3101  Pyrofield
2017-11-15  No. 3102  Hakuna Lasagna
2017-11-16  No. 3103  Garfield Plus Actual Fish Facts
2017-11-17  No. 3104  Alphabetical Blender
2017-11-18  No. 3105  Matrixfield
2017-11-19  No. 3106  Hypocrite Garfield
2017-11-20  No. 3107  Garfield but only when it's "Garfield"
2017-11-21  No. 3108  A Week in a Sunday
2017-11-22  No. 3109  A Softer Purr
2017-11-23  No. 3110  Garfield Lioness Garfield
2017-11-24  No. 3111  Kachi As Kachi Can
2017-11-25  No. 3112  You Know Nothing, Garfield
2017-11-26  No. 3113  See the Whites of The Eyes
2017-11-27  No. 3114  It's just a thing he's going through
2017-11-28  No. 3115  What we hate
2017-11-29  No. 3116  When Memes Collide
2017-11-30  No. 3117  It's Garfield!
2017-12-01  No. 3118  Garfield Sketched #5
2017-12-02  No. 3119  Passages
2017-12-03  No. 3120  The Gang Gets Sued By Jim Davis
2017-12-04  No. 3121  Garfield's First Diet
2017-12-05  No. 3122  A Strip Of Square Root Of Minus Garfield That Happened 2: Vanity, Thy Name Is Cat
2017-12-06  No. 3123  Days Till
2017-12-07  No. 3124  Nermfree Odielescents
2017-12-08  No. 3125  HTMLfield
2017-12-09  No. 3126  Dreamfield
2017-12-10  No. 3127  Telekinetic Liz
2017-12-11  No. 3128  Remains Gone Horribly Wrong
2017-12-12  No. 3129  White winter hymnal
2017-12-13  No. 3130  Gongfield
2017-12-14  No. 3131  Jon Adams
2017-12-15  No. 3132  Censorship
2017-12-16  No. 3133  Garfield Limited Special Collector's Ultimate Edition - SD Remix
2017-12-17  No. 3134  Garfield Emblem
2017-12-18  No. 3135  Garfield: 4koma Edition
2017-12-19  No. 3136  Snark Bait
2017-12-20  No. 3137  pןǝıɟǝɹǝɥdsıɯǝHuɹǝɥʇnoS
2017-12-21  No. 3138  A Random Garfield Generator
2017-12-22  No. 3139  Cannibals Can Be Crazy, Too
2017-12-23  No. 3140  Floodfield
2017-12-24  No. 3141  No, They'll Never Stop Making Frozen Pudding Pops.
2017-12-25  No. 3142  Look who's not invited
2017-12-26  No. 3143  Garfield Meets The Mackleberry Twins, or Now Do It for Nermal!
2017-12-27  No. 3144  Omeglefield 4
2017-12-28  No. 3145  Sour-faced Puss
2017-12-29  No. 3146  Mirrorverse Garfield
2017-12-30  No. 3147  Uninspired Comedy Sequel
2017-12-31  No. 3148  Mail Time
2018-01-01  No. 3149  So This Is The New Year
2018-01-02  No. 3150  Garfield Plus Garfielf
2018-01-03  No. 3151  Garfielf'd
2018-01-04  No. 3152  Alohafield
2018-01-05  No. 3153  Kingofthehillfield 2
2018-01-06  No. 3154  Action Kitton
2018-01-07  No. 3155  Orchidectomy Chapter I
2018-01-08  No. 3156  Another Inevitable Edit
2018-01-09  No. 3157  But It's Garfield
2018-01-10  No. 3158  Garfster of the House
2018-01-11  No. 3159  Garfield Sketched #6
2018-01-12  No. 3160  Garfield on a Minecraft Map​ Item
2018-01-13  No. 3161  Garfield Without This Stomach
2018-01-14  No. 3162  This one's real good broh
2018-01-15  No. 3163  Garfwood
2018-01-16  No. 3164  What is it?
2018-01-17  No. 3165  Odiesmobile
2018-01-18  No. 3166  Oh Happy Odie
2018-01-19  No. 3167  A Hell of a Yarn
2018-01-20  No. 3168  Garfield Made Slightly Family Friendly
2018-01-21  No. 3169  Sounds Of The Garfield Kingdom
2018-01-22  No. 3170  Embryonic Garfield
2018-01-23  No. 3171  The Sinister Mind Of Garfield Arbuckle
2018-01-24  No. 3172  Crayonfield
2018-01-25  No. 3173  Between the Missiles and Weapons Van Lights
2018-01-26  No. 3174  Chip Trip
2018-01-27  No. 3175  Making Jon Smarter (For A Change)
2018-01-28  No. 3176  Garfield Plus EmojiOne
2018-01-29  No. 3177  Jon Minus Hand-Eye Coordination
2018-01-30  No. 3178  Genuinely Jealous Garfield
2018-01-31  No. 3179  Superfeline Feats, Up To Eleven... Billion?
2018-02-01  No. 3180  The Dark Side of the Carolina Reaper
2018-02-02  No. 3181  SCPField
2018-02-03  No. 3182  What've You Done
2018-02-04  No. 3183  My Least Inspired Idea Yet
2018-02-05  No. 3184  Omit Needless Words
2018-02-06  No. 3185  Garfield but it's propaganda
2018-02-07  No. 3186  Sometimes, More Is More
2018-02-08  No. 3187  Slightly Less Me
2018-02-09  No. 3188  No Way to Delay that Sunday Comin' Every Day
2018-02-10  No. 3189  LCD's Sound System
2018-02-11  No. 3190  Another Garfield As _________
2018-02-12  No. 3191  Begin Again
2018-02-13  No. 3192  7 Grand Garfield
2018-02-14  No. 3193  Dog in Denial
2018-02-15  No. 3194  Lewi Lewi
2018-02-16  No. 3195  Carnivorous Plant
2018-02-17  No. 3196  GbettiaTGkaabetiinONsbetiiaenowGel*
2018-02-18  No. 3197  Reverse Psychology Garfield
2018-02-19  No. 3198  Double Reverse Quadruple Image Search
2018-02-20  No. 3199  Garfield Minus Error Message
2018-02-21  No. 3200  Alphabetical Blender (Really)
2018-02-22  No. 3201  Alphabetfield (Garfabet?)
2018-02-23  No. 3202  Key: GARFIELD
2018-02-24  No. 3203  Educational Programming
2018-02-25  No. 3204  Cat Pushups
2018-02-26  No. 3205  Cats' Eyes
2018-02-27  No. 3206  A Little Sandwich
2018-02-28  No. 3207  Table of the Dead
2018-03-01  No. 3208  The Voices
2018-03-02  No. 3209  Garfield 2057 Calendar
2018-03-03  No. 3210  Calzonal marking
2018-03-04  No. 3211  B
2018-03-05  No. 3212  Emojifield: Jon's Birthday Gift
2018-03-06  No. 3213  What A Luser
2018-03-07  No. 3214  Negative Continuity
2018-03-08  No. 3215  Sorry, Guys, But You Can't Just Laugh Hysterically At Every Stupid Thing And Assume It's Funny. The Big Bang Theory This Is Not. You Brought This Upon Yourselves.
2018-03-09  No. 3216  Remains Gone Horribly Wrong #2
2018-03-10  No. 3217  GOOOOOOOAAAAAAAAAAAALLLLLLLLLLL!
2018-03-11  No. 3218  The Cat Continuum
2018-03-12  No. 3219  Garfield, Quickster
2018-03-13  No. 3220  Garfield Minus Inexplicable Flipped Position
2018-03-14  No. 3221  Garhead
2018-03-15  No. 3222  Garfield Plus Spider Fact
2018-03-16  No. 3223  Obvious Pun (Boring)
2018-03-17  No. 3224  The Nuclear Option
2018-03-18  No. 3225  You shouldn't have given me the idea
2018-03-19  No. 3226  Z Late-Late Movie
2018-03-20  No. 3227  Jon Hates Raisins
2018-03-21  No. 3228  Airhead John
2018-03-22  No. 3229  Ear Worm... or Ants
2018-03-23  No. 3230  Garfield Minus Two Panels, Part II
2018-03-24  No. 3231  Phone It Out
2018-03-25  No. 3232  It's time for some game theory
2018-03-26  No. 3233  Garfield hates ice cream
2018-03-27  No. 3234  Look Back in Languor 2: Look Back-er
2018-03-28  No. 3235  Censored Garfield #2
2018-03-29  No. 3236  Jon Henry
2018-03-30  No. 3237  What on Earth am I Wearing?
2018-03-31  No. 3238  The tie keeps hanging
2018-04-01  No. 3239  Breeding Lymans out of the dead land
2018-04-02  No. 3240  The Void
2018-04-03  No. 3241  Orchidectomy Chapter II
2018-04-04  No. 3242  Heisenbark Double Uncertainty Principle
2018-04-05  No. 3243  Callback Boy
2018-04-06  No. 3244  Best before
2018-04-07  No. 3245  Garfield in slither.io
2018-04-08  No. 3246  Semper ubi sub ubi
2018-04-09  No. 3247  But what about this week's Movie Night?
2018-04-10  No. 3248  Applied Probability
2018-04-11  No. 3249  Garfun with Spin Panels
2018-04-12  No. 3250  The GarB System HD Remake
2018-04-13  No. 3251  Shoot Loops
2018-04-14  No. 3252  ICBMfield
2018-04-15  No. 3253  Suicide Hotline
2018-04-16  No. 3254  Breaking Point
2018-04-17  No. 3255  Six Layers of Lasagna Under
2018-04-18  No. 3256  Variations on Vegetarians
2018-04-19  No. 3257  50 Ways to Say Goodbye